FHL3 Human
Product Name : FHL3 HumanDescription : FHL3 Human Recombinant produced in E.Coli is a...
FHL2 Human
Product Name : FHL2 HumanDescription : FHL2 Human Recombinant produced in E.Coli is a...
FHIT Human, GST
Product Name : FHIT Human, GSTDescription : FHIT Human Recombinant full length protein expressed...
Ara h 8.0101
Product Name : Ara h 8.0101Description : Recombinant Ara h 8.0101 produced in SF9...
FHIT Human
Product Name : FHIT HumanDescription : FHIT Human Recombinant produced in E.Coli is a...
FGL1 Human
Product Name : FGL1 HumanDescription : FGL1 Human Recombinant produced in E.Coli is a...
FGG Human
Product Name : FGG HumanDescription : FGG Human Recombinant produced in E.Coli is a...
FGB Human
Product Name : FGB HumanDescription : FGB Human Recombinant produced in E.Coli is a...
FETUB Human
Product Name : FETUB HumanDescription : Fetuin-B Human Recombinant produced in HEK cells is...
Ferritin Human, FTL
Product Name : Ferritin Human, FTLDescription : Ferritin Human Recombinant Light Chain produced in...
ANAPC2 Monoclonal Antibody (OTI1H8), TrueMABâ„¢
Product Name : ANAPC2 Monoclonal Antibody (OTI1H8), TrueMABâ„¢Species Reactivity: Human, Mouse, RatHost/Isotype : Mouse...
Acid-C3-SSPy
Product Name : Acid-C3-SSPyDescription:Acid-C3-SSPy is a cleavable DBA-DM4 linker used in the synthesis of...
Ferritin Human
Product Name : Ferritin HumanDescription : Ferritin is a glycoprotein produced in Human Liver...
FUR E.Coli
Product Name : FUR E.ColiDescription : Ferric Uptake Regulator Recombinant produced in E.Coli is...
FDX1 Human
Product Name : FDX1 HumanDescription : FDX1 Human Recombinant fused with a 15 amino...
FDCSP Human
Product Name : FDCSP HumanDescription : FDCSP Human Recombinant produced in E.Coli is a...
Ara h 2.0201
Product Name : Ara h 2.0201Description : Recombinant Allergen Ara h 2.0201 produced in...
FCMR Human
Product Name : FCMR HumanDescription : FCMR Human Recombinant produced in E.Coli is a...
FCGRT Mouse
Product Name : FCGRT MouseDescription : FCGRT Mouse Recombinant produced in Sf9 Baculovirus cells...
FCGRT Human
Product Name : FCGRT HumanDescription : FCGRT Human Recombinant is a glycosylated, polypeptide chain...
FCER1A Human 201 a.a
Product Name : FCER1A Human 201 a.aDescription : FCER1A Human Recombinant produced in E.Coli...
FCER1A Human
Product Name : FCER1A HumanDescription : FCER1A Human Recombinant produced in E.Coli is a...
AMPK beta 1 (PRKAB1) Monoclonal Antibody (OTI3D10)
Product Name : AMPK beta 1 (PRKAB1) Monoclonal Antibody (OTI3D10)Species Reactivity: Human, Mouse, RatHost/Isotype...
S-(4-Hydroxybenzyl)glutathione
Product Name : S-(4-Hydroxybenzyl)glutathioneDescription:S-(4-Hydroxybenzyl)glutathione is a glutathione derivative. S-(4-Hydroxybenzyl)glutathione inhibits the in vitro binding...
FCER1A Human, HEK
Product Name : FCER1A Human, HEKDescription : FCER1A Human Recombinant produced in HEK293 Cells...
FCAR Human
Product Name : FCAR HumanDescription : FCAR produced in Sf9 Baculovirus cells is a...
FBXO6 Human
Product Name : FBXO6 HumanDescription : Background : Biological activity: Protein number : Q9NRD1Synonyms:...
FBXO2 Human
Product Name : FBXO2 HumanDescription : FBXO2 Human Recombinant produced in E.Coli is a...
FBLIM1 Human
Product Name : FBLIM1 HumanDescription : FBLIM1 Human Recombinant produced in E.coli is a...
Ara h 1.0101
Product Name : Ara h 1.0101Description : Recombinant Allergen Ara h 1.0101 produced in...
FANK1 Human
Product Name : FANK1 HumanDescription : FANK1 Human Recombinant produced in E.Coli is a...
FAM84B Human
Product Name : FAM84B HumanDescription : FAM84B Human Recombinant produced in E.coli is a...
FAM84A Human
Product Name : FAM84A HumanDescription : FAM84A Human Recombinant produced in E.coli is a...
FAM50A Human
Product Name : FAM50A HumanDescription : FAM50A Human Recombinant produced in E.Coli is a...
ALOX5 Monoclonal Antibody (OTI2C7), TrueMABâ„¢
Product Name : ALOX5 Monoclonal Antibody (OTI2C7), TrueMABâ„¢Species Reactivity: HumanHost/Isotype : Mouse / IgG1Class:MonoclonalType...
Lenalidomide-5-aminomethyl
Product Name : Lenalidomide-5-aminomethylDescription:Lenalidomide-5-aminomethyl is the Lenalidomide-based cereblon (CRBN) ligand used in the recruitment...
FAM49B Human
Product Name : FAM49B HumanDescription : FAM49B Human Recombinant produced in E.Coli is a...
FAM3D Human
Product Name : FAM3D HumanDescription : FAM3D Human Recombinant produced in E.Coli is a...
FAM3C Human
Product Name : FAM3C HumanDescription : FAM3C Human Recombinant produced in E.coli is a...
FAM3B Human
Product Name : FAM3B HumanDescription : FAM3B Protein is a 24.1 kDa protein containing...
FAM3A Human
Product Name : FAM3A HumanDescription : FAM3A Human Recombinant produced in E.Coli is a...
FAM107B Human
Product Name : FAM107B HumanDescription : FAM107B Human Recombinant produced in E.coli is a...
APTX Human
Product Name : APTX HumanDescription : APTX Human Recombinant fused to a 37 amino...
FAIM Human
Product Name : FAIM HumanDescription : FAIM Human Recombinant produced in E.Coli is a...
FADD Human
Product Name : FADD HumanDescription : FADD produced in E.Coli is a single, non-glycosylated...
F8 Human
Product Name : F8 HumanDescription : Human Factor VIII produced from Human Plasma contains...
ALDOB Monoclonal Antibody (OTI3C6), TrueMABâ„¢
Product Name : ALDOB Monoclonal Antibody (OTI3C6), TrueMABâ„¢Species Reactivity: HumanHost/Isotype : Mouse / IgG2bClass:MonoclonalType...
NK-252
Product Name : NK-252Description:NK-252 is a potential Nrf2 activator, which exhibits a great Nrf2-activating...
F8 Protein
Product Name : F8 ProteinDescription : Antihemophilic Facor Human Recombinant produced in CHO is...
F7 Human
Product Name : F7 HumanDescription : Factor VIIa Human Recombinant produced in BHK is...
FABP9 Human
Product Name : FABP9 HumanDescription : FABP9 Human Recombinant produced in E.Coli is a...
FABP7 Human, His
Product Name : FABP7 Human, HisDescription : FABP7 Human Recombinant produced in E.Coli is...
FABP7 Human
Product Name : FABP7 HumanDescription : FABP7 Human Recombinant produced in E.Coli is a...
FABP6 Human, His
Product Name : FABP6 Human, HisDescription : FABP6 Human Recombinant produced in E.Coli is...
FABP6 Human
Product Name : FABP6 HumanDescription : FABP6 Human Recombinant produced in E.Coli is a...
APP Human
Product Name : APP HumanDescription : APP Human Recombinant produced in E.Coli is a...
ACTA2 Human
Product Name : ACTA2 HumanDescription : ACTA2 Human Recombinant produced in E. coli is...
FABP5 Human, His
Product Name : FABP5 Human, HisDescription : FABP5 Human Recombinant produced in E.Coli is...
AKT1 Monoclonal Antibody (G.145.7)
Product Name : AKT1 Monoclonal Antibody (G.145.7)Species Reactivity: Human, Mouse, Non-human primate, RatHost/Isotype :...
Todralazine
Product Name : TodralazineDescription:Todralazine (Ecarazine) is an anti-hypertensive agent, acts as a β2AR blocker,...
FABP5 Human
Product Name : FABP5 HumanDescription : Recombinant Human Epidermal Fatty Acid Binding Protein (FABP-5)...
FABP4 Human, His
Product Name : FABP4 Human, HisDescription : FABP4 Human Recombinant produced in E.Coli is...
FABP4 Protein
Product Name : FABP4 ProteinDescription : 14.7kDa protein containing 132 amino acid residues.Background :...
FABP3 Human, His
Product Name : FABP3 Human, HisDescription : FABP3 Human Recombinant produced in E.Coli is...
FABP3 Human
Product Name : FABP3 HumanDescription : FABP3 Human Recombinant is a non-glycosylated polypeptide chain...
FABP2 Human, His
Product Name : FABP2 Human, HisDescription : FABP2 Human Recombinant produced in E.Coli is...
FABP1 Rat
Product Name : FABP1 RatDescription : FABP1 Rat Recombinant produced in E. coli is...
FABP1 Mouse
Product Name : FABP1 MouseDescription : Fatty Acid Binding Protein-1 Recombinant Mouse produced in...
FABP1 Human, His
Product Name : FABP1 Human, HisDescription : FABP1 Human Recombinant produced in E.Coli is...
APP Human, HEK
Product Name : APP Human, HEKDescription : APP Human Recombinant is a single, glycosylated,...
AKR1A1 Monoclonal Antibody (OTI8H2), TrueMABâ„¢
Product Name : AKR1A1 Monoclonal Antibody (OTI8H2), TrueMABâ„¢Species Reactivity: HumanHost/Isotype : Mouse / IgG2bClass:MonoclonalType...
β-Casomorphin, bovine TFA
Product Name : β-Casomorphin, bovine TFADescription:β-Casomorphin, bovine TFA (β-Casomorphin-7 (bovine) TFA) is a opioid...
FABP12 Human
Product Name : FABP12 HumanDescription : FABP12 Human Recombinant produced in E.Coli is a...
FABP1 Mouse, His
Product Name : FABP1 Mouse, HisDescription : FABP1 Mouse Recombinant produced in E.Coli is...
F3 Mouse
Product Name : F3 MouseDescription : F3 produced in Sf9 Baculovirus cells is a...
F11R Human
Product Name : F11R HumanDescription : F11R Human Recombinant produced in E.Coli is a...
EYA2 Human
Product Name : EYA2 HumanDescription : EYA2 Human Recombinant produced in E. coli is...
EXOSC9 Human
Product Name : EXOSC9 HumanDescription : EXOSC9 is a Full-length cDNA coding for the...
EXOSC8 Human
Product Name : EXOSC8 HumanDescription : EXOSC8 Human Recombinant produced in E.coli is a...
EXOSC7 Human
Product Name : EXOSC7 HumanDescription : EXOSC7 Human Recombinant produced in E.Coli is a...
EXOSC5 Human
Product Name : EXOSC5 HumanDescription : EXOSC5 Human Recombinant produced in E. coli is a...
EXOSC4 Human
Product Name : EXOSC4 HumanDescription : EXOSC4 Human Recombinant produced in E.Coli is a...
AIF Recombinant Rabbit Monoclonal Antibody (4B2)
Product Name : AIF Recombinant Rabbit Monoclonal Antibody (4B2)Species Reactivity: Human, RatHost/Isotype : Rabbit...
CL075
Product Name : CL075Description:CL075 (3M002) is a selective TLR8 agonist with immunomodulating properties. CL075...
APOBEC4 Human
Product Name : APOBEC4 HumanDescription : APOBEC4 Human Recombinant produced in E.Coli is a...
EXOSC3 Human
Product Name : EXOSC3 HumanDescription : EXOSC3 Human Recombinant produced in E.Coli is a...
EXOSC1 Human
Product Name : EXOSC1 HumanDescription : EXOSC1 Human Recombinant produced in E.Coli is a...
EXOSC10 Human
Product Name : EXOSC10 HumanDescription : EXOSC10 Human Recombinant produced in SF9 is a...
ETS2 Human
Product Name : ETS2 HumanDescription : ETS2 Human Recombinant produced in E.Coli is a...
ETHE1 Human
Product Name : ETHE1 HumanDescription : ETHE1 Human Recombinant produced in E.coli is a...
ETFB Human
Product Name : ETFB HumanDescription : ETFB Human Recombinant fused with a 20 amino...
ESM1 Human, HEK
Product Name : ESM1 Human, HEKDescription : ESM1 Human Recombinant produced in HEK293 cells...
ESM1 Human
Product Name : ESM1 HumanDescription : ESM1 Human Recombinant produced in E.Coli is a...
ESM1 Human, SF9
Product Name : ESM1 Human, SF9Description : ESM1 produced in Sf9 Baculovirus cells is...
AFP Monoclonal Antibody (C3)
Product Name : AFP Monoclonal Antibody (C3)Species Reactivity: HumanHost/Isotype : Mouse / IgG2a, kappaClass:MonoclonalType...
ASP-9521
Product Name : ASP-9521Description:ASP-9521 is a selective, orally bioavailable inhibitor of 17beta-hydroxysteroid dehydrogenase type...
ESAT6-CFP10
Product Name : ESAT6-CFP10Description : Recombinant Chimeric ESAT6-CFP10 produced in E. coli is fused...
APMAP Human
Product Name : APMAP HumanDescription : APMAP Human Recombinant produced in E.Coli is a...
ESAT6
Product Name : ESAT6Description : ESAT-6 Recombinant produced in Baculovirus is a single, glycosylated,...
ERP44 Human
Product Name : ERP44 HumanDescription : ERP44 Recombinant Human produced in E.Coli is a...
ERP27 Human
Product Name : ERP27 HumanDescription : ERP27 Human Recombinant fused with a 21 amino...
ERO1L Human
Product Name : ERO1L HumanDescription : ERO1L Human Recombinant produced in E.coli is a...
ERLIN2 Human
Product Name : ERLIN2 HumanDescription : ERLIN2 Human Recombinant produced in E.Coli is a...
ERH Human
Product Name : ERH HumanDescription : ERH Human Recombinant fused with a 23 amino acid...
ERGIC3 Human
Product Name : ERGIC3 HumanDescription : ERGIC3 Human Recombinant produced in E.Coli is a...
ERCC1 Human
Product Name : ERCC1 HumanDescription : ERCC1 Human Recombinant produced in E. coli is...
Loganic acid 6′-O-β-D-glucoside
Product Name : Loganic acid 6′-O-β-D-glucosideDescription:Loganic acid 6′-O-β-D-glucoside, a iridoidal glucoside, is isolated from...
EPYC Human
Product Name : EPYC HumanDescription : EPYC Human Recombinant produced in HEK293 Cells.is a...
EFNB1 Human, Sf9
Product Name : EFNB1 Human, Sf9Description : EFNB1 produced in Sf9 Baculovirus cells is...
APIP Human
Product Name : APIP HumanDescription : APIP Human Recombinant produced E. coli is a...
EFNA1 Human, Sf9
Product Name : EFNA1 Human, Sf9Description : EFNA1 produced in Sf9 Baculovirus cells is...
EPHB4 Mouse
Product Name : EPHB4 MouseDescription : EPHB4 Mouse Recombinant produced in Sf9 Baculovirus cells...
EPHB4 Human
Product Name : EPHB4 HumanDescription : EPHB4 produced in Sf9 Baculovirus cells is a...
EPHB2 Human
Product Name : EPHB2 HumanDescription : EPHB2 Human Recombinant produced in Sf9 Baculovirus cellsis...
EPHB1 Human
Product Name : EPHB1 HumanDescription : EPHB1 Human Recombinant produced in HEK293 Cells is...
EPHA4 Mouse
Product Name : EPHA4 MouseDescription : EPHA4 Mouse Recombinant produced in Sf9 Baculovirus cells...
EPHA2 Human, sf9
Product Name : EPHA2 Human, sf9Description : EPHA2 Human Recombinant produced in Sf9 Baculovirus...
3, 4-Dimethoxycinnamic acid
Product Name : 3, 4-Dimethoxycinnamic acidDescription:3,4-Dimethoxycinnamic acid (O-Methylferulic acid) is a monomer extracted and...
EPHA2 Human
Product Name : EphA2 HumanDescription : EphA2 Human Recombinant produced in HEK cells is...
EPCAM Human, sf9
Product Name : EPCAM Human, sf9Description : EPCAM produced in Sf9 Baculovirus cells is...
EPCAM Human
Product Name : EPCAM HumanDescription : EPCAM Human Recombinant produced in E.Coli is a...
AP3S1 Human
Product Name : AP3S1 HumanDescription : AP3S1 Human Recombinant produced in E. coli is...
ENSA Human
Product Name : ENSA HumanDescription : ENSA Human Recombinant produced in E.Coli is a...
ENHO Human
Product Name : ENHO HumanDescription : ENHO Human Recombinant produced in E.Coli is a...
Endostatin Human
Product Name : Endostatin HumanDescription : Endostatin Human Recombinant produced in E.Coli is a...
EMG1 Human
Product Name : EMG1 HumanDescription : EMG1 Human Recombinant produced in E. coli is a...
EMCN Human
Product Name : EMCN HumanDescription : EMCN Human Recombinant produced in E.Coli is a...
EMC2 Human
Product Name : EMC2 HumanDescription : EMC2 Human Recombinant produced in E.coli is a...
Clomipramine Hydrochloride
Product Name : Clomipramine HydrochlorideDescription:Clomipramine HCl inhibitor of mAChRs, 5-HT2/3/6/7 receptors, α1/2-adrenergic receptors, SERT,...
ELP5 Human
Product Name : ELP5 HumanDescription : ELP5 Human Recombinant produced in E.Coli is a...
ELP4 Human
Product Name : ELP4 HumanDescription : ELP4 Human Recombinant produced in E.Coli is a...
ELOB Mouse
Product Name : ELOB MouseDescription : ELOB Mouse Recombinant produced in E.Coli is a...
ELAVL2 Human
Product Name : ELAVL2 HumanDescription : ELAVL2 Human Recombinant produced in E.Coli is a...
AP1S2 Human
Product Name : AP1S2 HumanDescription : AP1S2 Human Recombinant produced in E.Coli is a...
PI3 Human, Sf9
Product Name : PI3 Human, Sf9Description : PI3 Human Recombinant produced in Sf9 Baculovirus...
EIF5A Human
Product Name : EIF5A HumanDescription : EIF5A produced in E.Coli is a single, non-glycosylated...
EIF5A2 Human
Product Name : EIF5A2 HumanDescription : EIF5A2 Recombinant E.coli produced in E.Coli is a...
EIF4H Human
Product Name : EIF4H HumanDescription : EIF4H Human Recombinant produced in E.Coli is a...
EIF4EBP3 Human
Product Name : EIF4EBP3 HumanDescription : EIF4EBP3 Human Recombinant produced in E.coli is a...
Amino-PEG15-amine
Product Name : Amino-PEG15-amineTag: CAS : Chemical Formula:C32H68N2O15Molecular Weight : 720.90Physical Form: colorless oil...
TOOS
Product Name : TOOSDescription:TOOS, a Trinder’s reagent, is a novel highly water-soluble aniline derivative;...
EIF4EBP2 Human
Product Name : EIF4EBP2 HumanDescription : EIF4EBP2 produced in E.Coli is a single, non-glycosylated...
EIF4EBP1 Human
Product Name : EIF4EBP1 HumanDescription : EIF4EBP1 Human Recombinant fused with a 20 amino...
EIF4E Mouse
Product Name : EIF4E MouseDescription : EIF4E Mouse Recombinant produced in E.Coli is a...
EIF4E Human
Product Name : EIF4E HumanDescription : EIF4E Human Recombinant produced in E.Coli is a...
EIF4A3 Human
Product Name : EIF4A3 HumanDescription : EIF4A3 Human Recombinant produced in E.Coli is a...
AP1AR Human
Product Name : AP1AR HumanDescription : AP1AR Human Recombinant produced in E.coli is a...
EIF3K Human
Product Name : EIF3K HumanDescription : EIF3K produced in E.Coli is a single, non-glycosylated...
EIF3J Human
Product Name : EIF3J HumanDescription : EIF3J Human Recombinant produced in E.coli is a...
EIF3I Human
Product Name : EIF3I HumanDescription : EIF3I Human Recombinant produced in E.Coli is a...
EIF3I Human, Sf9
Product Name : EIF3I Human, Sf9Description : EIF3I Human Recombinant produced in Sf9 Baculovirus...
Urinary prostacyclin ELISA kit
Product Name : Urinary prostacyclin ELISA kitSequence: Purity: Molecular Weight:Solubility : Appearance: Use/Stability :...
Griseofulvin
Product Name : GriseofulvinDescription:Apatinib, also known as Rivoceranib, is an orally bioavailable, small-molecule receptor...
EIF3F Human
Product Name : EIF3F HumanDescription : EIF3F Human Recombinant produced in E.Coli is a...
EIF2S1 Human
Product Name : EIF2S1 HumanDescription : EIF2S1 Recombinant Human produced in E.Coli is a...
EIF2B1 Human
Product Name : EIF2B1 HumanDescription : EIF2B1 produced in E.Coli is a single, non-glycosylated...
EIF1B Human
Product Name : EIF1B HumanDescription : EIF1B Human Recombinant fused with a 20 amino acid...
EIF1AY Human
Product Name : EIF1AY HumanDescription : EIF1AY produced in E.Coli is a single, non-glycosylated...
EIF1AX Human
Product Name : EIF1AX HumanDescription : EIF1AX Human Recombinant produced in E.Coli is a...
AOC1 Human
Product Name : AOC1 HumanDescription : AOC1 Human Recombinant produced in HEK cells is...
EIF1 Human
Product Name : EIF1 HumanDescription : EIF1 Human Recombinant produced in E.Coli is a...
EHF Human
Product Name : EHF HumanDescription : EHF Human Recombinant produced in E. coli is...
EGLN3 Human
Product Name : EGLN3 HumanDescription : EGLN3 Human Recombinant produced in E. coli is...
Toxin A (Clostridium difficile)
Product Name : Toxin A (Clostridium difficile)Sequence: Purity: Molecular Weight:~270kDaSolubility : Appearance: Use/Stability :...
Mycro 3
Product Name : Mycro 3Description:Mycro 3 is a potent and selective inhibitor of Myc-associated...
EGFP
Product Name : EGFPDescription : Recombinant EGFP produced in E.coli cells is a non-glycosylated,...
EFNB3 Human, Sf9
Product Name : EFNB3 Human, Sf9Description : EFNB3 produced in Sf9 Baculovirus cells is...
EFNB3 Human
Product Name : EFNB3 HumanDescription : EFNB3 Human Recombinant produced in E.Coli is a...
EFNB2 Mouse
Product Name : EFNB2 MouseDescription : EFNB2 Mouse Recombinant produced in Sf9 Baculovirus cells...
EFNB2 Human
Product Name : EFNB2 HumanDescription : EFNB2 Human Recombinant produced in E.Coli is a...
EFNB1 Human
Product Name : EFNB1 HumanDescription : EFNB1 Human Recombinant produced in E.coli is a...
EFNA5 Human
Product Name : EFNA5 HumanDescription : EFNA5 produced in Sf9 Baculovirus cells is a...
ANXA8L1 Human
Product Name : ANXA8L1 HumanDescription : ANXA8L1 Human Recombinant produced in E. coli is...
EFNA3 Human
Product Name : EFNA3 HumanDescription : EFNA3 Human Recombinant produced in E.Coli is a...
EFNA3 Human, Sf9
Product Name : EFNA3 Human, Sf9Description : EFNA3 Human Recombinant produced in Sf9 Baculovirus...
SK1-I
Product Name : SK1-ISequence: Purity: ≥98% (HPLC)Molecular Weight:313.9Solubility : Soluble in water or DMSO...
Kahweol
Product Name : KahweolDescription:Kahweol is one of the consituents of the coffee from Coffea...
Resveratrol
Product Name : ResveratrolSequence: Purity: ≥98% (HPLC)Molecular Weight:228.2Solubility : Soluble in DMSO (65mg/ml), 100%...
EFNA1 Human, HEK
Product Name : EFNA1 Human, HEKDescription : EFNA1 Human Recombinant produced in HEK293 cells...
EFNA1 Human
Product Name : EFNA1 HumanDescription : EFNA1 Human Recombinant produced in E.coli is a...
EEF2K Human
Product Name : EEF2K HumanDescription : EEF2K Human Recombinant produced in E.Coli is a...
EEF2 Human
Product Name : EEF2 HumanDescription : EEF2 Human Recombinant produced in E.coli is a...
EEF1G Human
Product Name : EEF1G HumanDescription : EEF1G Human Recombinant produced in E.coli is a...
EEF1E1 Human
Product Name : EEF1E1 HumanDescription : EEF1E1 produced in E.Coli is a single, non-glycosylated...
EEF1D Human
Product Name : EEF1D HumanDescription : EEF1D Human Recombinant fused with a 20 amino acid...
EEF1B2 Human
Product Name : EEF1B2 HumanDescription : EEF1B2 Human Recombinant fused with an 8 amino acid...
ANXA8 Human
Product Name : ANXA8 HumanDescription : ANXA8 Human Recombinant produced in E.Coli is a...
ACBD6 Human
Product Name : ACBD6 HumanDescription : ACBD6 Human Recombinant produced in E.Coli is a...
EEF1A1 Human
Product Name : EEF1A1 HumanDescription : EEF1A1 Human Recombinant produced in E.Coli is a...
EED Human
Product Name : EED HumanDescription : EED Human Recombinant produced in E. coli is...
EDF1 Human
Product Name : EDF1 HumanDescription : EDF1 Recombinant Human produced in E.Coli is a...
EDAR Human, Sf9
Product Name : EDAR Human, Sf9Description : EDAR produced in Sf9 Baculovirus cells is...
EDAR Human
Product Name : EDAR HumanDescription : EDAR Human Recombinant produced in E.Coli is a...
EDA2R Human, Sf9
Product Name : EDA2R Human, Sf9Description : EDA2R Human Recombinant produced in Sf9 Baculovirus...
EDA2R Human
Product Name : EDA2R HumanDescription : EDA2R Human Recombinant produced in E.Coli is a...
ECSIT Human
Product Name : ECSIT HumanDescription : ECSIT Human Recombinant produced in E. coli is...
EBAG9 Human
Product Name : EBAG9 HumanDescription : EBAG9 Human Recombinant produced in E.Coli is a...
EAF1 Human
Product Name : EAF1 HumanDescription : EAF1 Human Recombinant produced in E. coli is....
ANXA7 Human
Product Name : ANXA7 HumanDescription : ANXA7 Human Recombinant produced in E.Coli is a...
E Selectin Human
Product Name : E Selectin HumanDescription : E-Selectin Human Recombinant is expressed in E....
SELE Human, Sf9
Product Name : SELE Human, Sf9Description : SELE Human Recombinant produced in Sf9 Baculovirus...
Cadherin-E Human
Product Name : Cadherin-E HumanDescription : Cadherin-E Human Recombinant (aa 600-707) expressed in E.coli,...
DYNLT3 Human
Product Name : DYNLT3 HumanDescription : DYNLT3 Human Recombinant produced in E. coli is...
DYNLT1 Human
Product Name : DYNLT1 HumanDescription : DYNLT1 Human Recombinant produced in E.Coli is a...
DYNLRB2 Human
Product Name : DYNLRB2 HumanDescription : DYNLRB2 Human Recombinant fused with a 20 amino acid...
DYNLRB1 Human
Product Name : DYNLRB1 HumanDescription : DYNLRB1 Recombinant Human produced in E.Coli is a...
DYNLL2 Human
Product Name : DYNLL2 HumanDescription : DYNLL2 Human Recombinant produced in E.Coli is a...
DYNLL1 Human
Product Name : DYNLL1 HumanDescription : DYNLL1 Recombinant Human produced in E.Coli is a...
DTNBP1 Human
Product Name : DTNBP1 HumanDescription : DTNBP1 Human Recombinant fused to 37 a.a. N-terminal...
ANXA6 Human
Product Name : ANXA6 HumanDescription : ANXA6 produced in E.Coli is a single, non-glycosylated...
DSTN Human
Product Name : DSTN HumanDescription : DSTN Human Recombinant produced in E. coli is...
DsbG E.Coli
Product Name : DsbG E.ColiDescription : Recombinant DsbG produced in E.Coli is a single,...
DsbE E.Coli
Product Name : DsbE E.ColiDescription : Recombinant DsbE produced in E.Coli is a single,...
DRG1 Human
Product Name : DRG1 HumanDescription : DRG1 Human Recombinant produced in E.Coli is a...
DR1 Human
Product Name : DR1 HumanDescription : DR1 Recombinant Human produced in E.Coli is a...
DPY30 Human
Product Name : DPY30 HumanDescription : DPY30 Human Recombinant produced in E.Coli is a...
DPPA5 Human
Product Name : DPPA5 HumanDescription : DPPA5 Human Recombinant produced in E.Coli is a...
DPPA4 Human
Product Name : DPPA4 HumanDescription : DPPA4 Human Recombinant produced in E.coli is a...
DPPA3 Human
Product Name : DPPA3 HumanDescription : DPPA3 Human Recombinant produced in E.Coli is a...
DPH3P1 Human
Product Name : DPH3P1 HumanDescription : DPH3P1 Human Recombinant produced in E.Coli is a...
ANXA5 Mouse
Product Name : ANXA5 MouseDescription : ANXA5 Mouse Recombinant produced in E. coli is...
DPH2 Human
Product Name : DPH2 HumanDescription : DPH2 Human Recombinant produced in Sf9 Baculovirus cells...
DOK4 Human
Product Name : DOK4 HumanDescription : DOK4 Human Recombinant produced in E.Coli is a...
DNTTIP1 Human
Product Name : DNTTIP1 HumanDescription : DNTTIP1 Human Recombinant produced in E.coli is a...
DNALI1 Human
Product Name : DNALI1 HumanDescription : DNALI1 Human Recombinant produced in E.Coli is a...
DNAL4 Human
Product Name : DNAL4 HumanDescription : DNAL4 Human Recombinant produced in E.Coli is a...
DNAL1 Human
Product Name : DNAL1 HumanDescription : DNAL1 Human Recombinant produced in E. coli is...
Dnak SBD C-terminus E.Coli
Product Name : Dnak SBD C-terminus E.ColiDescription : Recombinant Dnak Substrate Binding Domain C-terminal...
DnaK SBD
Product Name : DnaK SBDDescription : Recombinant DnaK Substrate Binding domain produced in E.Coli...
DnaK Lid Covering Substrate E.Coli
Product Name : DnaK Lid Covering Substrate E.ColiDescription : Recombinant DnaK Lid Covering Substrate...
DnaK Human, His
Product Name : DnaK Human, HisDescription : HSP 70kDa produced in E.Coli is a...
ANXA5 Human
Product Name : ANXA5 HumanDescription : ANXA5 produced in E.Coli is a single, non-glycosylated...
DnaK E.coli
Product Name : DnaK E.coliDescription : Recombinant Dnak produced in E.Coli is a single,...
DnaK ATPase-BD E.Coli
Product Name : DnaK ATPase-BD E.ColiDescription : Recombinant DnaK Substrate Binding Domain produced in...
DNAJC27 Human
Product Name : DNAJC27 HumanDescription : DNAJC27 Human Recombinant produced in E.Coli is a...
DNAJC24 Human
Product Name : DNAJC24 HumanDescription : DNAJC24 Human Recombinant produced in E.Coli is a...
DNAJC19 Human
Product Name : DNAJC19 HumanDescription : DNAJC19 Human Recombinant fused with a 37 amino acid...
DNAJC15 Human
Product Name : DNAJC15 HumanDescription : DNAJC15 Human Recombinant produced in E.Coli is a...
DNAJC12 Human
Product Name : DNAJC12 HumanDescription : DNAJC12 Human Recombinant produced in E. coli is...
DNAJB8 Human
Product Name : DNAJB8 HumanDescription : DNAJB8 Human Recombinant produced in E.Coli is a...
DNAJB6 Human
Product Name : DNAJB6 HumanDescription : DNAJB6 Human Recombinant fused with a 23 amino...
DNAJB4 Human
Product Name : DNAJB4 HumanDescription : DNAJB4 Human Recombinant produced in E.Coli is a...
ANXA4 Human
Product Name : ANXA4 HumanDescription : ANXA4 produced in E.Coli is a single, non-glycosylated...
DNAJB2 Human
Product Name : DNAJB2 HumanDescription : DNAJB2 Human Recombinant fused with a 23 amino...
DNAJB11 Human
Product Name : DNAJB11 HumanDescription : DNAJB11 produced in E.Coli is a single, non-glycosylated...
DnaJ Human
Product Name : DnaJ HumanDescription : HSP40 Human Recombinant produced in E.Coli is a...
DnaJ E.Coli
Product Name : DnaJ E.ColiDescription : Recombinant Dna-J produced in E.Coli is a single,...
DLX3 Human
Product Name : DLX3 HumanDescription : DLX3 Human Recombinant produced in E.Coli is a...
DLL4 Mouse
Product Name : DLL4 MouseDescription : DLL4 produced in Sf9 Baculovirus cells is a...
DLL4 Human
Product Name : DLL4 HumanDescription : DLL4 Human Recombinant produced in HEK293 is a...
DLK1 Human, HEK
Product Name : DLK1 Human, HEKDescription : DLK1 Human Recombinant produced in HEK293 Cells...
DLK1 Human
Product Name : DLK1 HumanDescription : DLK1 Human Recombinant produced in Sf9 Baculovirus cells...
DKK3 Human, Sf9
Product Name : DKK3 Human, Sf9Description : DKK3 Human Recombinant produced in Sf9 Baculovirus...
ANXA3 Human
Product Name : ANXA3 HumanDescription : ANXA3 produced in E.Coli is a single, non-glycosylated...
DKK3 Human, HEK
Product Name : DKK3 Human, HEKDescription : DKK3 Human Recombinant is a single polypeptide...
DKK3 Human
Product Name : DKK3 HumanDescription : DKK3 Human Recombinant produced in E. coli is...
DKK2 Human
Product Name : DKK2 HumanDescription : DKK2 Human Recombinant produced in E. coli is...
DKK1 Human Sf9
Product Name : DKK1 Human Sf9Description : DKK1 produced in Sf9, Baculovirus cells is...
DKK1 Mouse
Product Name : DKK1 MouseDescription : DKK1 Mouse Recombinant produced in HEK293 cells is...
DIRAS1 Human
Product Name : DIRAS1 HumanDescription : DIRAS1 Human Recombinant produced in E.Coli is a...
DGCR6L Human
Product Name : DGCR6L HumanDescription : DGCR6L Human Recombinant produced in E.Coli is a...
DGCR6 Human
Product Name : DGCR6 HumanDescription : DGCR6 Human Recombinant produced in E.Coli is a...
DFFA Human
Product Name : DFFA HumanDescription : DFFA Human Recombinant fused with 20 amino acid...
Desmin Human
Product Name : Desmin HumanDescription : Desmin Human Recombinant having a calculated molecular mass...
ANXA2
Product Name : ANXA2Description : ANXA2 Human Recombinant produced in E.Coli is a single,...
Der P1
Product Name : Der P1Description : The E.Coli derived recombinant protein contains the Dermatophagoides...
Der F1
Product Name : Der F1Description : The E.Coli derived recombinant protein contains the Dermatophagoides...
DENR Human
Product Name : DENR HumanDescription : DENR Human Recombinant produced in E.coli is a...
DEDD Human
Product Name : DEDD HumanDescription : DEDD Human Recombinant produced in E.Coli is a...
DDX56 Human
Product Name : DDX56 HumanDescription : DDX56 Human Recombinant produced in E.Coli is a...
DDX39A Human
Product Name : DDX39A HumanDescription : DDX39A Human Recombinant produced in E.Coli is a...
DDIT4 Human
Product Name : DDIT4 HumanDescription : DDIT4 produced in E.Coli is a single, non-glycosylated...
DDIT3 Human
Product Name : DDIT3 HumanDescription : DDIT3 Human Recombinant produced in E.Coli is a...
DCUN1D4 Human
Product Name : DCUN1D4 HumanDescription : DCUN1D4 Human Recombinant produced in E.coli is a...
DCUN1D2 Human
Product Name : DCUN1D2 HumanDescription : DCUN1D2 Human Recombinant produced in E.Coli is a...
ANXA1 Mouse
Product Name : ANXA1 MouseDescription : ANXA1 Mouse Recombinant produced in E.Coli is a...
DCUN1D1 Human
Product Name : DCUN1D1 HumanDescription : DCUN1D1 produced in E.Coli is a single, non-glycosylated...
DCTN6 Human
Product Name : DCTN6 HumanDescription : DCTN6 Human Recombinant produced in E.Coli is a...
DCTN2 (1-406) Human
Product Name : DCTN2 (1-406) HumanDescription : Dynactin 2 Human Recombinant produced in E.Coli...
DCTN2 (1-403) Human
Product Name : DCTN2 (1-403) HumanDescription : Dynactin 2 Human Recombinant produced in E.Coli...
DCTN2 (1-401) Human
Product Name : DCTN2 (1-401) HumanDescription : Dynactin 2 Human Recombinant produced in E.Coli...
DCN Mouse
Product Name : DCN MouseDescription : DCN produced in Sf9 Baculovirus cells is a...
DCN Human, Sf9
Product Name : DCN Human, Sf9Description : DCN produced in Sf9 Baculovirus cells is...
DCN Human
Product Name : DCN HumanDescription : DCN Human Recombinant produced in E.Coli is a...
DCAF7 Human
Product Name : DCAF7 HumanDescription : DCAF7 Human Recombinant produced in E.Coli is a...
DBR1 Human
Product Name : DBR1 HumanDescription : DBR1 Human Recombinant produced in E.coli is a...
ANXA1 Human
Product Name : ANXA1 HumanDescription : ANXA1 produced in E.Coli is a single, non-glycosylated...
DBNDD2 Human
Product Name : DBNDD2 HumanDescription : DBNDD2 Human Recombinant produced in E.Coli is a...
DBNDD1 Human
Product Name : DBNDD1 HumanDescription : DBNDD1 Human Recombinant produced in E.Coli is a...
DBI Mouse
Product Name : DBI MouseDescription : DBI Mouse Recombinant produced in E.Coli is a...
DBI Human
Product Name : DBI HumanDescription : DBI Human Recombinant produced in E.Coli is a...
DAP Human
Product Name : DAP HumanDescription : DAP Human Recombinant produced in E.Coli is a...
DAG1 Human
Product Name : DAG1 HumanDescription : DAG1 Human Recombinant produced in E.Coli is a...
CYTIP Human
Product Name : CYTIP HumanDescription : CYTIP Human Recombinant produced in E.Coli is a...
CYTH3 Human
Product Name : CYTH3 HumanDescription : CYTH3 Human Recombinant produced in E.coli is a...
CYTH2 Human
Product Name : CYTH2 HumanDescription : CYTH2 Human Recombinant produced in E. coli is...
CYTH1 Human
Product Name : CYTH1 HumanDescription : CYTH1 Human Recombinant produced in E.Coli is a...
ANXA13 Human
Product Name : ANXA13 HumanDescription : ANXA13 Human Recombinant fused with a 20 amino...
ABRACL Human
Product Name : ABRACL HumanDescription : ABRACL Human Recombinant produced in E.Coli is a...
CST3 Rat
Product Name : CST3 RatDescription : Total 134 AA, Mw: 14.93 kDa (calculated). N-terminal...
CST3 Mouse
Product Name : CST3 MouseDescription : Cystatin-C Murine Recombinant produced in E.Coli is a...
CST3 k9
Product Name : CST3 k9Description : Cystatin-C Protein is a 14.85 kDa protein containing...
CST3 Protein, His
Product Name : CST3 Protein, HisDescription : Cystatin-C Human Recombinant produced in E.Coli is...
CST3 Human
Product Name : CST3 HumanDescription : Background : Biological activity: Protein number : P01034Synonyms:...
CST3 Human, Pichia
Product Name : CST3 Human, PichiaDescription : Recombinant Human Cystatin C is having a...
Cystatin-C Protein
Product Name : Cystatin-C ProteinDescription : Cystatin-C Human Recombinant produced in E.Coli is a...
CST3 Human, His Active
Product Name : CST3 Human, His ActiveDescription : CST3 Human Recombinant produced in E.Coli...
CSTB Human
Product Name : CSTB HumanDescription : CSTB Human Recombinant fused to a 20 a.a...
Cys-Protein-L
Product Name : Cys-Protein-LDescription : Recombinant Protein-L produced in E.Coli is a single non-glycosylated...
ANXA11 Human
Product Name : ANXA11 HumanDescription : ANXA11 Human Recombinant produced in E.coli is a...
Cys-Protein-A/G/L
Product Name : Cys-Protein-A/G/LDescription : Recombinant Protein-A/G/L produced in E.Coli is a single non-glycosylated...
Cys-Protein-G
Product Name : Cys-Protein-GDescription : Cys-Protein G Recombinant produced in E.Coli, is a single...
CYP2E1 Human
Product Name : CYP2E1 HumanDescription : CYP2E1 Human Recombinant produced in E.Coli is a...
CYP2D6
Product Name : CYP2D6Description : Cytochrome P450 2D6 Human Recombinant (also called liver/kidney microsomal...
CYGB Human
Product Name : CYGB HumanDescription : CYGB Recombinant Human produced in E.Coli is a...
CYB5R3 Human
Product Name : CYB5R3 HumanDescription : CYB5R3 Human Recombinant produced in E.coli is a...
CYB5A Human, Sf9
Product Name : CYB5A Human, Sf9Description : CYB5A produced in Sf9 Baculovirus cells is...
CYB5A Human
Product Name : CYB5A HumanDescription : CYB5A Human Recombinant produced in E.Coli is a...
CXADR Human
Product Name : CXADR HumanDescription : CXADR Human Recombinant produced in E.coli is a...
CUZD1 Human
Product Name : CUZD1 HumanDescription : CUZD1 Human Recombinant produced in HEK cells is...
ANXA10 Human
Product Name : ANXA10 HumanDescription : ANXA10 Human Recombinant produced in E.Coli is a...
CUTC Human
Product Name : CUTC HumanDescription : CUTC Human Recombinant produced in E.Coli is a...
CUTA Human
Product Name : CUTA HumanDescription : CUTA Human Recombinant produced in E.Coli is a...
CUL1 Human
Product Name : CUL1 HumanDescription : CUL1 produced in E.Coli is a single, non-glycosylated...
CUEDC2 Human
Product Name : CUEDC2 HumanDescription : CUEDC2 Human Recombinant produced in E.coli is a...
CUEDC1 Human
Product Name : CUEDC1 HumanDescription : CUEDC1 Human Recombinant produced in E.Coli is a...
ctxB
Product Name : ctxBDescription : Cholera Toxin B subunit Recombinant produced in E.Coli is...
CSTB Human, Active
Product Name : CSTB Human, ActiveDescription : CSTB Human Recombinant produced in E.Coli is...
CTNNBIP1 Human
Product Name : CTNNBIP1 HumanDescription : CTNNBIP1 Recombinant E.coli produced in E.Coli is a...
CTHRC1 Human, HEK
Product Name : CTHRC1 Human, HEKDescription : CTHRC1 Human Recombinant produced in HEK cells...
CTHRC1 Human
Product Name : CTHRC1 HumanDescription : CTHRC1 Human Recombinant produced in E.Coli is a...
ANTXR2 Mouse
Product Name : ANTXR2 MouseDescription : ANTXR2 produced in Sf9 Insect cells is a...
CTHRC1 Human, Sf9
Product Name : CTHRC1 Human, Sf9Description : CTHRC1 produced in Sf9 Baculovirus cells is...
CTBP1 Human
Product Name : CTBP1 HumanDescription : CTBP1 produced in E.Coli is a single, non-glycosylated...
CSTF1 Human, sf9
Product Name : CSTF1 Human, sf9Description : CSTF1 Human Recombinant produced in Sf9 Baculovirus...
CSTF1 Human
Product Name : CSTF1 HumanDescription : CSTF1 Human Recombinant produced in E.Coli is a...
CSTA Human, His
Product Name : CSTA Human, HisDescription : CSTA produced in E.Coli is a single,...
CSTA Human, Active
Product Name : CSTA Human, ActiveDescription : Cystatin A Human Recombinant produced in E.Coli...
CST9 Human
Product Name : CST9 HumanDescription : CST9 Human Recombinant produced in E.coli is a...
CST7 Human
Product Name : CST7 HumanDescription : CST7 Human Recombinant produced in E. coli is...
CST6 Human
Product Name : CST6 HumanDescription : CST6 Human Recombinant produced in E.coli is a...
CST6 Human, Active
Product Name : CST6 Human, ActiveDescription : CST6 Human Recombinant produced in E.Coli is...
ANTXR2 Human
Product Name : ANTXR2 HumanDescription : ANTXR2 Human Recombinant produced in E.coli is a...
CST5 Human
Product Name : CST5 HumanDescription : CST5 Human Recombinant produced in Sf9 Baculovirus cells...
CST4 Human, sf9
Product Name : CST4 Human, sf9Description : CST4 produced in Sf9 Baculovirus cells is...
CST4 Human
Product Name : CST4 HumanDescription : CST4 Human Recombinant produced in E. coli is...
CST3 Rat, sf9
Product Name : CST3 Rat, sf9Description : CST3 Rat Recombinant produced in Sf9 Baculovirus...
CST3 Mouse, sf9
Product Name : CST3 Mouse, sf9Description : CST3 produced in Sf9 Insect cells is...
CST3 Mouse, Active
Product Name : CST3 Mouse, ActiveDescription : CST3 Mouse produced in Sf9 Insect cells...
CST1 Human
Product Name : CST1 HumanDescription : CST1 Human Recombinant produced in E.Coli is a...
CST11 Human
Product Name : CST11 HumanDescription : CST11 Human Recombinant produced in E.Coli is a...
CSRP2 Human
Product Name : CSRP2 HumanDescription : CSRP2 Human Recombinant produced in E. coli is...
CSN2 Human
Product Name : CSN2 HumanDescription : CSN2 Human Recombinant produced in E.Coli is a...
AMH Human, HEK
Product Name : AMH Human, HEKDescription : AMH Human Recombinant is a single, glycosylated...
CSDC2 Human
Product Name : CSDC2 HumanDescription : CSDC2 Human Recombinant produced in E.coli is a...
CSAG1 Human
Product Name : CSAG1 HumanDescription : CSAG1 Human Recombinant produced in E.coli is a...
CRYZ Human
Product Name : CRYZ HumanDescription : CRYZ Human Recombinant produced in E.Coli is a...
CRYM Human
Product Name : CRYM HumanDescription : CRYM Human Recombinant produced in E.Coli is a...
CRYGS Human
Product Name : CRYGS HumanDescription : CRYGS Human Recombinant produced in E.coli is a...
CRYGN Human
Product Name : CRYGN HumanDescription : CRYGN Human Recombinant produced in E.Coli is a...
CRYGD Mouse
Product Name : CRYGD MouseDescription : CRYGD Mouse Recombinant produced in E.Coli is a...
CRYGD Human
Product Name : CRYGD HumanDescription : CRYGD Human Recombinant produced in E.Coli is a...
CRYGC Human
Product Name : CRYGC HumanDescription : CRYGC Human Recombinant produced in E. coli is...
CRYBB1 Human
Product Name : CRYBB1 HumanDescription : CRYBB1 Recombinant Human produced in E.Coli is a...
ANP32A Human
Product Name : ANP32A HumanDescription : ANP32A Human Recombinant produced in E.Coli is a...
CRYBA4 Human
Product Name : CRYBA4 HumanDescription : CRYBA4 Human Recombinant produced in E.Coli is a...
CRYAB Mouse
Product Name : CRYAB MouseDescription : Recombinant CRYAB Mouse produced in E.Coli is a...
CRYAB Human
Product Name : CRYAB HumanDescription : Recombinant CRYAB produced in E.Coli is a single,non-glycosylated...
CRYAB Human, His
Product Name : CRYAB Human, HisDescription : CRYAB Human Recombinant produced in E.coli is...
CRYAA Human
Product Name : CRYAA HumanDescription : Recombinant Human CRYAA produced in E.Coli is a...
CRTAP Human
Product Name : CRTAP HumanDescription : CRTAP Human Recombinant produced in E. coli is....
CRP Rat
Product Name : CRP RatDescription : CRP produced in Sf9 Insect cells is a...
CRP (19-224 a.a) Human
Product Name : CRP (19-224 a.a) HumanDescription : CRP Human Recombinant produced in E.Coli...
CRP Mouse
Product Name : CRP MouseDescription : CRP Mouse Recombinant produced in Sf9 Baculovirus cells...
CRP Canine
Product Name : CRP CanineDescription : CRP Canine Recombinant is a single, glycosylated polypeptide...
ANKRD54 Human
Product Name : ANKRD54 HumanDescription : ANKRD54 Human Recombinant produced in E.Coli is a...
CRNN Human
Product Name : CRNN HumanDescription : CRNN Human Recombinant fused to 20 amino acid...
CRMP1 Mouse
Product Name : CRMP1 MouseDescription : CRMP1 Mouse Recombinant produced in E.Coli is a...
CRMP1 Human
Product Name : CRMP1 HumanDescription : CRMP1 Human Recombinant produced in E.Coli is a...
CRKL Human
Product Name : CRKL HumanDescription : CRKL Human Recombinant fused with a 20 amino...
CRK Human
Product Name : CRK HumanDescription : CRK Human Recombinant fused with a 20 amino...
CRISP3 Human
Product Name : CRISP3 HumanDescription : CRISP3 Human Recombinant produced in E.Coli is a...
CRISP2 Human
Product Name : CRISP2 HumanDescription : CRISP2 Human Recombinant produced in E.Coli is a...
CRISP1 Human
Product Name : CRISP1 HumanDescription : The CRISP1 Protein Human produced in E.Coli is...
CRIPT Human
Product Name : CRIPT HumanDescription : CRIPT Human Recombinant produced in E. coli is...
CRIP1 Human
Product Name : CRIP1 HumanDescription : CRIP1 Human Recombinant produced in E.Coli is a...
ANKRD1 Human
Product Name : ANKRD1 HumanDescription : ANKRD1 Human Recombinant produced in E. coli is...
CREG1 Mouse
Product Name : CREG1 MouseDescription : CREG1 Mouse Recombinant produced in E. coli is...
CREG1 Human
Product Name : CREG1 HumanDescription : CREG1 Human Recombinant produced in E. coli is...
CREBZF Human
Product Name : CREBZF HumanDescription : CREBZF Human Recombinant produced in E.Coli is a...
CREB3L2 Human
Product Name : CREB3L2 HumanDescription : CREB3L2 Human Recombinant produced in E.Coli is a...
CRCP Human
Product Name : CRCP HumanDescription : CRCP Human Recombinant produced in E.coli is a...
CRADD Human
Product Name : CRADD HumanDescription : CRADD Human Recombinant produced in E.Coli is a...
CRABP2 Human
Product Name : CRABP2 HumanDescription : CRABP2 Human Recombinant produced in E.Coli is a...
CRABP1 Human
Product Name : CRABP1 HumanDescription : CRABP1 Human Recombinant produced in E.Coli is a...
CPSF4 Human
Product Name : CPSF4 HumanDescription : CPSF4 Human Recombinant produced in E.Coli is a...
CPPED1 Human
Product Name : CPPED1 HumanDescription : CPPED1 Human Recombinant produced in E. coli is...
ANKRA2 Human
Product Name : ANKRA2 HumanDescription : ANKRA2 Human Recombinant produced in E.Coli is a...
CPLX1 Human
Product Name : CPLX1 HumanDescription : CPLX1 Human Recombinant fused with a 20 amino...
CPEB1 Human
Product Name : CPEB1 HumanDescription : CPEB1 Human Recombinant produced in E.coli is a...
COX5B Human
Product Name : COX5B HumanDescription : COX5B Human Recombinant produced in E.Coli is a...
COX5A Human
Product Name : COX5A HumanDescription : COX5A Human Recombinant produced in E.Coli is a...
COX4NB Human
Product Name : COX4NB HumanDescription : COX4NB Human Recombinant produced in E.coli is a...
COTL1 Human
Product Name : COTL1 HumanDescription : COTL1 Human Recombinant fused with a 20 amino...
Cor a 1.0401
Product Name : Cor a 1.0401Description : Recombinant Cor a 1.0401 produced in SF9...
Cor a 1.0103
Product Name : Cor a 1.0103Description : Recombinant Major pollen allergen Cor a 1...
Cor a 9
Product Name : Cor a 9Description : The native protein Corylus Avellana Cor a...
Cor a 8.0101
Product Name : Cor a 8.0101Description : Recombinant Non-specific Lipid-Transfer Protein Cor a 8...
Ang K1-3 Human
Product Name : Ang K1-3 HumanDescription : Angiostatin Human Recombinant produced in E.coli is...
ABI3 Human
Product Name : ABI3 HumanDescription : ABI3 Human Recombinant produced in E. coli is...
Cor a 14.0101
Product Name : Cor a 14.0101Description : Recombinant 2S albumin produced in SF9 is...
COPZ1 Human
Product Name : COPZ1 HumanDescription : COPZ1 Human Recombinant fused with a 20 amino...
COPS8 Human
Product Name : COPS8 HumanDescription : COPS8 Human Recombinant produced in E.coli is a...
COPS7A Human
Product Name : COPS7A HumanDescription : COPS7A Human Recombinant produced in E.coli is a...
COPS6 Human
Product Name : COPS6 HumanDescription : COPS6 Human Recombinant produced in E.Coli is a...
COPE Human
Product Name : COPE HumanDescription : COPE Human Recombinant produced in E.Coli is a...
Conglutin
Product Name : ConglutinDescription : Recombinant Conglutin produced in SF9 is a glycosylated, polypeptide...
C4c Human
Product Name : C4c HumanDescription : Human C4c produced in Human plasma having a...
C3c Human
Product Name : C3c HumanDescription : Human C3c produced in Human Plasma having a...
C1q Human
Product Name : C1q HumanDescription : Human Complement Component C1q produced in Human plasma...
ANG Human, Sf9
Product Name : ANG Human, Sf9Description : ANG produced in Sf9 Baculovirus cells is...
CFP Human, Native
Product Name : CFP Human, NativeDescription : CFP Human produced in Human plasma having...
CFB Human, Native
Product Name : CFB Human, NativeDescription : Human Complement Factor B produced in Human...
CFB (260-764) Human, Sf9
Product Name : CFB (260-764) Human, Sf9Description : CFB Human Recombinant produced in Sf9...
C5a Protein
Product Name : C5a ProteinDescription : Human Complement C5a produced in Human plasma having...
COMP Human, HEK
Product Name : COMP Human, HEKDescription : COMP HEK Protein is a 82.4 kDa...
COMP Human
Product Name : COMP HumanDescription : COMP Human Recombinant produced in HEK293 Cells is...
COMMD9 Human
Product Name : COMMD9 HumanDescription : COMMD9 Human Recombinant produced in E. coli is...
COMMD7 Human
Product Name : COMMD7 HumanDescription : COMMD7 Human Recombinant produced in E.Coli is a...
COMMD6 Human
Product Name : COMMD6 HumanDescription : COMMD6 Human Recombinant produced in E.coli is a...
COMMD1 Human
Product Name : COMMD1 HumanDescription : COMMD1 Recombinant Human produced in E.Coli is a...
ANG Human
Product Name : ANG HumanDescription : ANG Human Recombinant produced in E.coli is a...
Collagen-VI Bovine
Product Name : Collagen-VI BovineDescription : Bovine Collagen-VI is a natural protein purified from...
Collagen-V Bovine
Product Name : Collagen-V BovineDescription : Bovine Collagen-V is a natural protein purified from...
Collagen-IV Bovine
Product Name : Collagen-IV BovineDescription : Bovine Collagen-IV is a natural protein purified from...
Collagen-III Bovine
Product Name : Collagen-III BovineDescription : Mouse Collagen-III is a natural protein purified from...
Collagen-II Bovine
Product Name : Collagen-II BovineDescription : Bovine Collagen-II is a natural protein purified from...
Collagen-II Human
Product Name : Collagen-II HumanDescription : Human Collagen-II is a natural protein purified from...
Collagen-I Mouse
Product Name : Collagen-I MouseDescription : Mouse Collagen-I is a natural protein purified from...
Collagen-I Goat
Product Name : Collagen-I GoatDescription : Goat Collagen-I is a natural protein purified from...
Collagen-I Bovine
Product Name : Collagen-I BovineDescription : Bovine Collagen-I is a natural protein purified from...
COL4A3BP Human
Product Name : COL4A3BP HumanDescription : COL4A3BP Recombinant Human produced in E.Coli is a...
Anaplasma p44
Product Name : Anaplasma p44Description : Recombinant Anaplasma p44 produced in E.Coli is a...
COL4A3 Human
Product Name : COL4A3 HumanDescription : Human α3 chain of collagen IV; identical with...
COA4 Human
Product Name : COA4 HumanDescription : COA4 Human Recombinant produced in E.Coli is a...
CNRIP1 Human
Product Name : CNRIP1 HumanDescription : CNRIP1 Human Recombinant produced in E. coli is...
CNPY4 Human
Product Name : CNPY4 HumanDescription : CNPY4 Human Recombinant produced in E.Coli is a...
CNPY3 Human
Product Name : CNPY3 HumanDescription : CNPY3 Human Recombinant produced in E.Coli is a...
CNPY1 Human
Product Name : CNPY1 HumanDescription : CNPY1 Human Recombinant produced in E.Coli is a...
CNOT8 Human
Product Name : CNOT8 HumanDescription : CNOT8 Human Recombinant produced in E.coli is a...
CNOT7 Mouse
Product Name : CNOT7 MouseDescription : CNOT7 Mouse Recombinant produced in E.Coli is a...
CNN2 Human
Product Name : CNN2 HumanDescription : CNN2 Human Recombinant produced in E.Coli is a...
CNN1 Human
Product Name : CNN1 HumanDescription : CNN1 Human Recombinant produced in E. coli is...
Anaplasma Msp5
Product Name : Anaplasma Msp5Description : Recombinant Anaplasma Msp5 produced in SF9 is a...
CNBP Human
Product Name : CNBP HumanDescription : CNBP Human Recombinant produced in E.Coli is a...
CMC4 Human
Product Name : CMC4 HumanDescription : CMC4 Human Recombinant produced in E.Coli is a...
CMC1 Human
Product Name : CMC1 HumanDescription : CMC1 Human Recombinant produced in E.Coli is a...
CLTB Human
Product Name : CLTB HumanDescription : CLTB Human Recombinant produced in E.Coli is a...
CLTA Human
Product Name : CLTA HumanDescription : CLTA Human Recombinant produced in E.Coli is a...
CLPS Human
Product Name : CLPS HumanDescription : CLPS Human Recombinant produced in E.coli is a...
CLNS1A Human
Product Name : CLNS1A HumanDescription : CLNS1A Human Recombinant produced in E. coli is...
CLMP Human, SF9
Product Name : CLMP Human, SF9Description : CLMP produced in Sf9 Baculovirus cells is...
CLMP Human
Product Name : CLMP HumanDescription : CLMP Human Recombinant produced in E.coli is a...
CLIC4 Human
Product Name : CLIC4 HumanDescription : CLIC4 Human Recombinant fused with a 20 amino acid...
Anaplasma OmpA
Product Name : Anaplasma OmpADescription : Anaplasma OmpA produced in E.Coli is a single,...
CLIC2 Human
Product Name : CLIC2 HumanDescription : CLIC2 produced in E.Coli is a single, non-glycosylated...
CLIC1 Human
Product Name : CLIC1 HumanDescription : CLIC1 Human Recombinant produced in E.Coli is a...
CLEC7A Human
Product Name : CLEC7A HumanDescription : CLEC7A Human Recombinant produced in Sf9 Baculovirus cells...
CLEC5A Human
Product Name : CLEC5A HumanDescription : CLEC5A Human Recombinant produced in E.Coli is a...
CLEC5A Human, Sf9
Product Name : CLEC5A Human, Sf9Description : CLEC5A produced in Sf9 Baculovirus cells is...
CLEC4M Human
Product Name : CLEC4M HumanDescription : CLEC4M Human Recombinant produced in Sf9 Baculovirus cells...
CLEC4E Human
Product Name : CLEC4E HumanDescription : CLEC4E Human Recombinant produced in E.Coli is a...
CLEC2D Human
Product Name : CLEC2D HumanDescription : CLEC2D Human Recombinant produced in E.Coli is a...
CLEC2B Human, Sf9
Product Name : CLEC2B Human, Sf9Description : CLEC2B produced in Sf9 Baculovirus cells is...
CLEC2B Human
Product Name : CLEC2B HumanDescription : CLEC2B Human Recombinant produced in E.Coli is a...
ANAPC13 Human
Product Name : ANAPC13 HumanDescription : ANAPC13 Human Recombinant produced in E.Coli is a...
CLEC1B Human, Sf9
Product Name : CLEC1B Human, Sf9Description : CLEC1B Human Recombinant produced in Sf9 Baculovirus...
CLEC1B Human
Product Name : CLEC1B HumanDescription : CLEC1B Human Recombinant produced in E.Coli is a...
CLEC10A Human
Product Name : CLEC10A HumanDescription : CLEC10A Human Recombinant produced in Sf9 Insect cells...
CLDN4 Human
Product Name : CLDN4 HumanDescription : The CLDN4 Protein Human is produced in E....
CKS1B Human
Product Name : CKS1B HumanDescription : CKS1B Human Recombinant produced in E.coli is a...
CITED2 Human
Product Name : CITED2 HumanDescription : CITED2 Human Recombinant produced in E.Coli is a...
CISD1 Human
Product Name : CISD1 HumanDescription : CISD1 Human Recombinant produced in E. coli is...
CIRBP Human
Product Name : CIRBP HumanDescription : CIRBP produced in E.Coli is a single, non-glycosylated...
CIDEC Human
Product Name : CIDEC HumanDescription : CIDEC Human Recombinant produced in E.Coli is a...
CIAPIN1 Human
Product Name : CIAPIN1 HumanDescription : CIAPIN1 Human Recombinant produced in E.Coli is a...
AMTN Human
Product Name : AMTN HumanDescription : AMTN Human Recombinant produced in E.Coli is a...
CIAO1 Human
Product Name : CIAO1 HumanDescription : CIAO1 Human Recombinant produced in E.Coli is a...
CHGA Human, His
Product Name : CHGA Human, HisDescription : Recombinant Human CHGA produced in E.Coli is...
CHGA Human
Product Name : CHGA HumanDescription : Recombinant Human CHGA produced in E.Coli is a...
CHGA Human, Sf9
Product Name : CHGA Human, Sf9Description : CHGA produced in Sf9 Baculovirus cells is...
CHRNA6 Human
Product Name : CHRNA6 HumanDescription : CHRNA6 Human Recombinant produced in E.Coli is a...
CHRNA3 Human
Product Name : CHRNA3 HumanDescription : CHRNA3 Human Recombinant produced in E.Coli is a...
CHRAC1 Human
Product Name : CHRAC1 HumanDescription : CHRAC1 Human Recombinant produced in E.Coli is a...
CHP Human
Product Name : CHP HumanDescription : CHP Recombinant E.coli produced in E.Coli is a...
CHODL Human
Product Name : CHODL HumanDescription : CHODL Human Recombinant produced in E.coli is a...
CHMP6 Human
Product Name : CHMP6 HumanDescription : CHMP6 Human Recombinant produced in E.Coli is a...
AMN Human
Product Name : AMN HumanDescription : AMN Human Recombinant produced in E.Coli is a...
CHMP5 Human
Product Name : CHMP5 HumanDescription : CHMP5 Human Recombinant produced in E. coli is...
CHMP4A Human
Product Name : CHMP4A HumanDescription : CHMP4A Human Recombinant produced in E.coli is a...
CHMP2B Human
Product Name : CHMP2B HumanDescription : CHMP2B Human Recombinant produced in E.coli is a...
CHMP2A Human
Product Name : CHMP2A HumanDescription : CHMP2A Human Recombinant fused with a 20 amino...
CHMP1B Human
Product Name : CHMP1B HumanDescription : CHMP1B Human Recombinant produced in E.Coli is a...
CHMP1A Human
Product Name : CHMP1A HumanDescription : CHMP1A Human Recombinant produced in E.Coli is a...
CHGB Human
Product Name : CHGB HumanDescription : CHGB Human Recombinant produced in E.Coli is a...
CHGA Human, HEK
Product Name : CHGA Human, HEKDescription : CHGA Human Recombinant is a single, glycosylated...
RARRES2 Human, HEK
Product Name : RARRES2 Human, HEKDescription : RARRES2 produced in Sf9 Baculovirus cells is...
CHD4 Human
Product Name : CHD4 HumanDescription : CHD4 is a full-length cDNA coding for the...
AMMECR1L Human
Product Name : AMMECR1L HumanDescription : AMMECR1L Human Recombinant produced in E.coli is a...
CHCHD7 Human
Product Name : CHCHD7 HumanDescription : CHCHD7 Human Recombinant produced in E.Coli is a...
CHCHD3 Human
Product Name : CHCHD3 HumanDescription : CHCHD3 Human Recombinant produced in E.Coli is a...
CHAC2 Human
Product Name : CHAC2 HumanDescription : CHAC2 Human Recombinant produced in E.coli is a...
CGREF1 Human
Product Name : CGREF1 HumanDescription : CGREF1 Human Recombinant produced in E.Coli is a...
CGB3 Human
Product Name : CGB3 HumanDescription : CGB3 Human Recombinant produced in Sf9 Baculovirus cells...
CFP Human
Product Name : CFP HumanDescription : CFP Human Recombinant produced in E.Coli is a...
CFLAR Human
Product Name : CFLAR HumanDescription : CFLAR Human Recombinant produced in E.coli is a...
CFL2 Human
Product Name : CFL2 HumanDescription : CFL2 Human Recombinant produced in E.Coli is a...
CFL1 Human
Product Name : CFL1 HumanDescription : Cofilin1 Human Recombinant (aa 1-166) fused to a...
CFI Human
Product Name : CFI HumanDescription : Human Complement Factor I produced in Human plasma...
AMIGO2 Human
Product Name : AMIGO2 HumanDescription : AMIGO2 produced in Sf9 Insect cells is a...
ABHD12B Human
Product Name : ABHD12B HumanDescription : ABHD12B Human Recombinant produced in E.Coli is a...
CFH Rat
Product Name : CFH RatDescription : Rat Complement Factor H produced in Rat plasma...
CFH Human
Product Name : CFH HumanDescription : Human Complement Factor H produced in Human plasma...
CFD Human
Product Name : CFD HumanDescription : Human Complement Factor D produced in Human plasma...
CFB Human, Sf9
Product Name : CFB Human, Sf9Description : CFB Human Recombinant produced in Sf9 Baculovirus...
CFB Human
Product Name : CFB HumanDescription : CFB Human Recombinant produced in E.coli is a...
CFB (26-259) Human
Product Name : CFB (26-259) HumanDescription : CFB (26-259) Human Recombinant produced in E....
CFB-a Human
Product Name : CFB-a HumanDescription : CFB-a Human produced in Human Plasma having a...
CFB-b Human
Product Name : CFB-b HumanDescription : CFB-b Human produced in Human Plasma having a...
CETN3 Human
Product Name : CETN3 HumanDescription : CETN3 Human Recombinant produced in E.Coli is a...
CETN2 Human
Product Name : CETN2 HumanDescription : CETN2 Human Recombinant fused with a 20 amino...
AMH Human
Product Name : AMH HumanDescription : AMH Human Recombinant produced in E. coli is...
CETN1 Human
Product Name : CETN1 HumanDescription : CETN1 Human Recombinant produced E. coli is a...
CENPU Human
Product Name : CENPU HumanDescription : CENPU Human Recombinant produced in E.Coli is a...
CENPQ Human
Product Name : CENPQ HumanDescription : CENPQ Human Recombinant produced in E.Coli is a...
CENPP Human
Product Name : CENPP HumanDescription : CENPP Human Recombinant produced in E.Coli is a...
CENPM Human
Product Name : CENPM HumanDescription : CENPM Human Recombinant produced in E.coli is a...
CENPH Human
Product Name : CENPH HumanDescription : CENPH Human Recombinant produced in E.coli is a...
CENPB Human
Product Name : CENPB HumanDescription : CENPB Human Recombinant produced in SF9 is a...
CENPA Human
Product Name : CENPA HumanDescription : CENPA Human Recombinant produced in SF9 is a...
CEND1 Human
Product Name : CEND1 HumanDescription : CEND1 Human Recombinant produced in E.Coli is a...
CECR1 Human
Product Name : CECR1 HumanDescription : CECR1 Human Recombinant produced in Sf9 Baculovirus cells...
AMELX Human
Product Name : AMELX HumanDescription : AMELX Human Recombinant produced in E.Coli is a...
CEBP Gamma Human
Product Name : CEBP Gamma HumanDescription : CEBP-g Recombinant Human His-Tag fusion protein produced...
CEBP Alpha Human
Product Name : CEBP Alpha HumanDescription : CEBP-a Human Recombinant His-Tag fusion protein produced...
CEACAM8 Human
Product Name : CEACAM8 HumanDescription : CEACAM8 Human produced in Sf9 Baculovirus cells is...
CEACAM7 Human
Product Name : CEACAM7 HumanDescription : CEACAM7 Human Recombinant produced in E.Coli is a...
CEACAM6 Human
Product Name : CEACAM6 HumanDescription : CEACAM6 Human Recombinant produced in Sf9 Baculovirus cells...
CEA Human, His
Product Name : CEA Human, HisDescription : CEA Human Recombinant produced in Sf9 Baculovirus...
CEACAM3 Human, Sf9
Product Name : CEACAM3 Human, Sf9Description : CEACAM3 Human Recombinant produced in Sf9 Baculovirus...
CEACAM3 Human
Product Name : CEACAM3 HumanDescription : CEACAM3 Human Recombinant produced in E.Coli is a...
CEACAM21 Human
Product Name : CEACAM21 HumanDescription : CEACAM21 Human Recombinant produced in E.coli is a...
CEACAM1 Human
Product Name : CEACAM1 HumanDescription : CEACAM1 produced in Sf9 Baculovirus cells is a...
AMBP
Product Name : AMBPDescription : AMBP Human Recombinant produced in E.coli is a single,...
CDKN2AIPNL Human
Product Name : CDKN2AIPNL HumanDescription : CDKN2AIPNL Human Recombinant produced in E. coli is....
CDK5RAP3 Human
Product Name : CDK5RAP3 HumanDescription : CDK5RAP3 Human Recombinant produced in E.Coli is a...
CDHR5 Mouse
Product Name : CDHR5 MouseDescription : CDHR5 Mouse Recombinant produced in Sf9 Baculovirus cells...
CDH5 Mouse
Product Name : CDH5 MouseDescription : CDH5 produced in Sf9 Insect cells is a...
CDH5 Human
Product Name : CDH5 HumanDescription : Cadherin 5 Human Recombinant produced in Sf9 Baculovirus...
CDH2 Human
Product Name : CDH2 HumanDescription : CDH2 Human Recombinant produced in Sf9 Baculovirus cells...
CDH1 Human, Sf9
Product Name : CDH1 Human, Sf9Description : CDH1 produced in Sf9 Baculovirus cells is...
CDH1 Human, HEK
Product Name : CDH1 Human, HEKDescription : E-Cadherin Human Recombinant produced in HEK cells...
CDH11 Human
Product Name : CDH11 HumanDescription : CDH11 Human Recombinant produced in E.Coli is a...
CDCP1 Human
Product Name : CDCP1 HumanDescription : CDCP1 produced in Sf9 Baculovirus cells is a...
SNCA 1-95, Human
Product Name : SNCA 1-95, HumanDescription : SNCA Human Recombinant produced in E.Coli is...
CDC42 Human
Product Name : CDC42 HumanDescription : CDC42 Human Recombinant fused with a 15 amino...
CDC37 Human
Product Name : CDC37 HumanDescription : CDC37 Human Recombinant produced in E.Coli is a...
CDC37 Human, His
Product Name : CDC37 Human, HisDescription : CDC37, His Protein is a 45.71 kDa...
CDC34 Human, His
Product Name : CDC34 Human, HisDescription : CDC34 Human Recombinant protein fused to a...
CDC34 Human
Product Name : CDC34 HumanDescription : Cell Division Cycle 34 Human Recombinant produced in...
CDC26 Human
Product Name : CDC26 HumanDescription : CDC26 Human Recombinant produced in E.Coli is a...
CDC25A Human
Product Name : CDC25A HumanDescription : CDC25A Human Recombinant fused with a 36 amino acid...
CDC123 Human
Product Name : CDC123 HumanDescription : CDC123 Human Recombinant produced in E.Coli is a...
SIRPA Human, HEK
Product Name : SIRPA Human, HEKDescription : SIRPA Human Recombinant produced in HEK293 cells...
SELPLG Human
Product Name : SELPLG HumanDescription : SELPLG Human Recombinant produced in HEK293 Cells is...
Aln G 4.0101
Product Name : Aln G 4.0101Description : Recombinant Polcalcin Aln g 4 produced in...
CCS Human
Product Name : CCS HumanDescription : CCS Human Recombinant produced in E.Coli is a...
CCM2 Human
Product Name : CCM2 HumanDescription : CCM2 Human Recombinant produced in E.Coli is a...
CCDC90B Human
Product Name : CCDC90B HumanDescription : CCDC90B Human Recombinant produced in E.Coli is a...
CCDC69 Human
Product Name : CCDC69 HumanDescription : CCDC69 Human Recombinant produced in E.Coli is a...
CCDC43 Human
Product Name : CCDC43 HumanDescription : CCDC43 Human Recombinant produced in E. coli is...
CCDC25 Human
Product Name : CCDC25 HumanDescription : CCDC25 Human Recombinant produced in E.Coli is a...
CCDC23 Human
Product Name : CCDC23 HumanDescription : CCDC23 Human Recombinant produced in E.Coli is a...
CCDC104 Human
Product Name : CCDC104 HumanDescription : CCDC104 Human Recombinant produced in E.Coli is a...
CCDC101 Human
Product Name : CCDC101 HumanDescription : CCDC101 Human Recombinant produced in E. coli is...
CBX5 Human
Product Name : CBX5 HumanDescription : CBX5 Human Recombinant produced in E. coli is...
Aln G 1.0101
Product Name : Aln G 1.0101Description : Recombinant Major pollen allergen Aln g 1...
CBX3 Human
Product Name : CBX3 HumanDescription : CBX3 Human Recombinant produced in E. coli is...
CBX1 Human
Product Name : CBX1 HumanDescription : CBX1 Human Recombinant produced in E.coli is a...
CBFB HUman
Product Name : CBFB HUmanDescription : CBFB Recombinant Human produced in E.Coli is a...
CASQ2 Human
Product Name : CASQ2 HumanDescription : CASQ2 Human Recombinant fused to 37 amino acid...
CARHSP1 Human
Product Name : CARHSP1 HumanDescription : CRAHSP1 Human Recombinant fused with a 20 amino...
TNNI3 Human, (1-210)
Product Name : TNNI3 Human, (1-210)Description : TNNI3 Human Recombinant produced in E.Coli is...
Troponin-C Protein
Product Name : Troponin-C ProteinDescription : Troponin-C Human produced from Human Cardiac Tissue, having...
Cardiac Actin Bovine
Product Name : Cardiac Actin BovineDescription : Ultra pure Cardiac Actin having a Molecular...
TNNT2 Human
Product Name : TNNT2 HumanDescription : Cardiac Muscle Troponin T Human Recombinant produced in...
CARD18 Human
Product Name : CARD18 HumanDescription : CARD18 Human Recombinant produced in E. coli is a...
AIP Human
Product Name : AIP HumanDescription : AIP Human Recombinant produced in E.Coli is a...
CARD17 Human
Product Name : CARD17 HumanDescription : CARD17 Human Recombinant produced in E.coli is a...
CEA Human
Product Name : CEA HumanDescription : CEA Human Recombinant is glycosylated with N-linked sugars...
Car b 1.0109
Product Name : Car b 1.0109Description : Recombinant Pollen allergen Car b 1 isoform...
CAPZA2 Human
Product Name : CAPZA2 HumanDescription : CAPZA2 Human Recombinant produced in E.Coli is a...
CAPSL Human
Product Name : CAPSL HumanDescription : CAPSL Human Recombinant produced in E.coli is a...
CAPS Human
Product Name : CAPS HumanDescription : CAPS Human Recombinant fused with a 20 amino acid...
CAPNS1 Human
Product Name : CAPNS1 HumanDescription : CAPNS1 Human Recombinant produced in E.coli is a...
CAPG Human
Product Name : CAPG HumanDescription : CAPG Human Recombinant produced in E.Coli is a...
CANX Human
Product Name : CANX HumanDescription : CANX Human Recombinant produced in E.Coli is a...
CANT1 Human
Product Name : CANT1 HumanDescription : CANT1 Human Recombinant produced in E.Coli is a...
AIFM1 Human
Product Name : AIFM1 HumanDescription : AIFM1 Human Recombinant produced in E.coli is a...
C.Albicans PLB1
Product Name : C.Albicans PLB1Description : Recombinant Candida Albicans Phospholipase B1 (24-526 a.a) produced...
CAMP Human
Product Name : CAMP HumanDescription : CAMP Human Recombinant produced in E.Coli is a...
CAMLG Human
Product Name : CAMLG HumanDescription : CAMLG Human Recombinant produced in E.coli is a...
Calumenin Human
Product Name : Calumenin HumanDescription : Calumenin Human Recombinant produced in E. coli is...
Calumenin Human, His
Product Name : Calumenin Human, HisDescription : Recombinant Human Calumenin produced in E.Coli is...
CALR Human
Product Name : CALR HumanDescription : CALR Human Recombinant produced in E.Coli is a...
CALR3 Human
Product Name : CALR3 HumanDescription : CALR3 Human Recombinant produced in E.Coli is a...
CALN1 Human
Product Name : CALN1 HumanDescription : CALN1 Human Recombinant fused with a 20 amino...
CALM2 Human 135 a.a
Product Name : CALM2 Human 135 a.aDescription : CALM2 Human Recombinant full length protein...
CALML5 Human
Product Name : CALML5 HumanDescription : CALML5 Human Recombinant produced in E.Coli is a...
AIDA Human
Product Name : AIDA HumanDescription : AIDA Human Recombinant produced in E.Coli is a...
CALML3 Human
Product Name : CALML3 HumanDescription : CALML3 Human Recombinant produced in E.Coli is a...
CALB2 Mouse
Product Name : CALB2 MouseDescription : Calretinin Mouse Recombinant full length protein expressed in...
CALM2 Human
Product Name : CALM2 HumanDescription : Recombinant CALM2 produced in E.Coli is a single,...
C.Albicans Enolase
Product Name : C.Albicans EnolaseDescription : Recombinant Candida Albicans Enolase produced in SF9 is...
CALB2 Human
Product Name : CALB2 HumanDescription : CALB2 Human Recombinant produced in E.Coli is a...
CALB1 Rat
Product Name : CALB1 RatDescription : Recombinant Rat Calbindin-1 produced in E.Coli.The Rat CALB1...
CALB1 Human
Product Name : CALB1 HumanDescription : CALB1 Human Recombinant produced in E.Coli is a...
CADM1 Human
Product Name : CADM1 HumanDescription : CADM1 Human Recombinant produced in E.Coli is a...
CACYBP Human
Product Name : CACYBP HumanDescription : CACYBP Human Recombinant produced in E.Coli is a...
CABP7 Human
Product Name : CABP7 HumanDescription : CABP7 produced in E.Coli is a single, non-glycosylated...
AHSP Human
Product Name : AHSP HumanDescription : AHSP Human Recombinant produced in E.Coli is a...
AAMDC Human
Product Name : AAMDC HumanDescription : AAMDC Human Recombinant produced in E.Coli is a...
CAB39L Human
Product Name : CAB39L HumanDescription : CAB39L Human Recombinant produced in E.Coli is a...
CAB39 Human
Product Name : CAB39 HumanDescription : CAB39 Recombinant Human produced in E.Coli is a...
C9ORF95 Human
Product Name : C9ORF95 HumanDescription : C9ORF95 Human Recombinant produced in E.Coli is a...
C9ORF103 Human
Product Name : C9ORF103 HumanDescription : C9ORF103 Human Recombinant produced in E.coli is a...
C9 Human
Product Name : C9 HumanDescription : Human Complement C9 produced in Human plasma is...
C8G Human
Product Name : C8G HumanDescription : C8G Human Recombinant produced in E.coli is a...
C8 Human
Product Name : C8 HumanDescription : Human Complement C8 produced in Human plasma is...
C7ORF49 Human
Product Name : C7ORF49 HumanDescription : C7ORF49 Human Recombinant produced in E. coli is...
C7 Human
Product Name : C7 HumanDescription : Human Complement C7 produced in Human plasma having...
C6ORF108 Human
Product Name : C6ORF108 HumanDescription : C6ORF108 produced in E.Coli is a single, non-glycosylated...
AHSG Mouse
Product Name : AHSG MouseDescription : AHSG produced in Sf9 Baculovirus cells is a...
C6 Human
Product Name : C6 HumanDescription : Human Complement C6 produced in Human plasma having...
C5a Mouse
Product Name : C5a MouseDescription : C5a Mouse Recombinant produced in E.Coli is a...
C5a Human
Product Name : C5a HumanDescription : C5a Human Recombinant produced in E.Coli is a...
C5 Human
Product Name : C5 HumanDescription : Human Complement C5 produced in Human plasma having...
C4BPB Human
Product Name : C4BPB HumanDescription : C4BPB Human Recombinant produced in E.Coli is a...
C4BP Human
Product Name : C4BP HumanDescription : C4BP Human produced in Human Plasma having a...
C4b Human
Product Name : C4b HumanDescription : Human Complement C4b produced in Human plasma is...
C4a Human
Product Name : C4a HumanDescription : Human Complement C4a produced in Human plasma having...
C4 Human
Product Name : C4 HumanDescription : Human Complement C4 produced in Human plasma having...
C3d Human
Product Name : C3d HumanDescription : Human Complement C3d produced in Human plasma having...
AHSG Human HEK
Product Name : AHSG Human HEKDescription : AHSG Human Recombinant produced by transfected human...
C3b Rat
Product Name : C3b RatDescription : Rat Complement C3b produced in Rat plasma having...
C3b Rabbit
Product Name : C3b RabbitDescription : Rabbit Complement C3b is composed of 2 disulfide-linked...
C3b Inactivated Mouse
Product Name : C3b Inactivated MouseDescription : Mouse Complement C3b Inactivated produced in Mouse...
C3b Mouse
Product Name : C3b MouseDescription : Mouse Complement C3b produced in Mouse plasma having...
C3b Human
Product Name : C3b HumanDescription : Human Complement C3b produced in Human plasma having...
C3a Human
Product Name : C3a HumanDescription : Human Complement C3a produced in Human plasma is...
C3 Rat
Product Name : C3 RatDescription : Rat Complement C3 produced in Rat plasma having...
C3 Rabbit
Product Name : C3 RabbitDescription : Rabbit Complement C3 produced in Rabbit plasma having...
C3 Mouse
Product Name : C3 MouseDescription : Mouse Complement C3 produced in Mouse plasma having...
C3 Human
Product Name : C3 HumanDescription : Human Complement C3 produced in Human plasma having...
AHSG Human
Product Name : AHSG HumanDescription : AHSG Human Recombinant produced in E.Coli is a...
C20ORF20 Human
Product Name : C20ORF20 HumanDescription : C20ORF20 Human Recombinant produced in E.Coli is a...
C2 Human
Product Name : C2 HumanDescription : Human Complement C2 produced in Human plasma having...
C1S Human
Product Name : C1S HumanDescription : Human Complement C1s produced in Human plasma having...
C1R Human
Product Name : C1R HumanDescription : Human Complement C1r produced in Human plasma having...
C1QTNF9 Human
Product Name : C1qTNF9 HumanDescription : C1qTNF9 Protein is a 33.7 kDa protein containing 324...
C1QTNF8 Human
Product Name : C1qTNF8 HumanDescription : C1qTNF8 Human Recombinant produced in E.Coli is a...
C1QTNF7 Human
Product Name : C1qTNF7 HumanDescription : C1qTNF7 Human Recombinant produced in E.Coli is a...
C1QTNF6 Human
Product Name : C1qTNF6 HumanDescription : C1qTNF6 Human Recombinant produced in E.Coli is a...
C1QTNF5 Human
Product Name : C1QTNF5 HumanDescription : C1QTNF5 Human produced in E.Coli is a single,...
ZWINT Human
Product Name : ZWINT HumanDescription : ZWINT Human Recombinant produced in E.coli is a...
ZWILCH Human
Product Name : ZWILCH HumanDescription : ZWILCH Human Recombinant produced in E.Coli is a...
C1QTNF4 Human
Product Name : C1qTNF4 HumanDescription : C1qTNF4 Human Recombinant produced in HEK cells is...
AHA1 Human
Product Name : AHA1 HumanDescription : AHA1 Human Recombinant produced in E.Coli is a...
ZNRD1 Human
Product Name : ZNRD1 HumanDescription : ZNRD1 Human Recombinant produced in E.Coli is a...
ZNHIT3 Human
Product Name : ZNHIT3 HumanDescription : ZNHIT3 Human Recombinant produced in E.coli is a...
ZNHIT1 Human
Product Name : ZNHIT1 HumanDescription : ZNHIT1 Human Recombinant produced in E.coli is a...
ZNF689 Human
Product Name : ZNF689 HumanDescription : ZNF689 Human Recombinant produced in E. coli is...
ZNF514 Human
Product Name : ZNF514 HumanDescription : ZNF514 Human Recombinant produced in E.Coli is a...
ZNF346 Human
Product Name : ZNF346 HumanDescription : ZNF346 Human Recombinant produced in E.coli is a...
ZNF32 Human
Product Name : ZNF32 HumanDescription : ZNF32 Human Recombinant produced in E.Coli is a...
ZMAT3 Human
Product Name : ZMAT3 HumanDescription : ZMAT3 Human Recombinant produced in E.coli is a...
ZG16 Human
Product Name : ZG16 HumanDescription : ZG16 Human Recombinant produced in E. coli is...
ZFAND5 Human
Product Name : ZFAND5 HumanDescription : ZFAND5 Human Recombinant produced in E.Coli is a...
C1QTNF3 Human
Product Name : C1qTNF3 HumanDescription : C1qTNF3 Human Recombinant produced in E.Coli is a...
ZFAND3 Human
Product Name : ZFAND3 HumanDescription : ZFAND3 Human Recombinant produced in E.coli is a...
ZFAND1 Human
Product Name : ZFAND1 HumanDescription : ZFAND1 Human Recombinant produced in E.Coli is a...
ZCCHC17 Human
Product Name : ZCCHC17 HumanDescription : ZCCHC17 produced in E.Coli is a single, non-glycosylated...
ZCCHC12 Human
Product Name : ZCCHC12 HumanDescription : ZCCHC12 Human Recombinant produced in E.Coli is a...
ZADH2 Human
Product Name : ZADH2 HumanDescription : ZADH2 Human Recombinant produced in E. coli is...
AZGP1 Human, Sf9
Product Name : AZGP1 Human, Sf9Description : AZGP1 Human Recombinant produced in Sf9 Baculovirus...
YY1 Human
Product Name : YY1 HumanDescription : YY1 Human Recombinant produced in E. coli is...
Y.Enterocolitica (O:9) YopE
Product Name : Y.Enterocolitica (O:9) YopEDescription : Recombinant Yersinia Enterocolitica (O:9) YopE in E.coli...
Y.Enterocolitica (O:9) YopB
Product Name : Y.Enterocolitica (O:9) YopBDescription : Recombinant Yersinia Enterocolitica (O:9) YopB produced in...
YIF1B Human
Product Name : YIF1B HumanDescription : YIF1B Human Recombinant produced in E. coli is...
C1QTNF2 Human
Product Name : C1qTNF2 HumanDescription : C1qTNF2 Protein is a 29,640 Da protein containing...
Y.Enterocolitica (O:9) YopN
Product Name : Y.Enterocolitica (O:9) YopNDescription : Recombinant Yersinia Enterocolitica (O:9) YopN produced in...
Y.Enterocolitica (O:9) YopM
Product Name : Y.Enterocolitica (O:9) YopMDescription : Recombinant Yersinia Enterocolitica (O:9) YopM produced in...
Y.Enterocolitica (O:9) YopH
Product Name : Y.Enterocolitica (O:9) YopHDescription : Recombinant Yersinia Enterocolitica (O:9) YopH produced in...
Y.Enterocolitica (O:9) YopD
Product Name : Y.Enterocolitica (O:9) YopDDescription : Recombinant Yersinia Enterocolitica (O:9) YopD produced in...
Y.Enterocolitica (O:9) LcrV
Product Name : Y.Enterocolitica (O:9) LcrVDescription : Recombinant Yersinia Enterocolitica (O:9) LcrV produced in...
Y.Enterocolitica (O:8) YopM
Product Name : Y.Enterocolitica (O:8) YopMDescription : Recombinant Yersinia Enterocolitica (O:8) YopM produced in...
YEATS4 Human
Product Name : YEATS4 HumanDescription : YEATS4 Human Recombinant produced in E.Coli is a...
YBX1 Human
Product Name : YBX1 HumanDescription : YBX1 Human Recombinant produced in E.Coli is a...
YAE1D1 Human
Product Name : YAE1D1 HumanDescription : YAE1D1 Human Recombinant produced in E.coli is a...
XRCC3 Human
Product Name : XRCC3 HumanDescription : XRCC3 Human Recombinant produced in E.Coli is a...
C1QTNF1 Human
Product Name : C1qTNF1 HumanDescription : C1qTNF1 Human Recombinant produced in E.Coli is a...
XRCC2 Human
Product Name : XRCC2 HumanDescription : XRCC2 Human Recombinant produced in E.coli is a...
XPA Human
Product Name : XPA HumanDescription : XPA Human Recombinant produced in E.Coli is a...
XG Human
Product Name : XG HumanDescription : XG Human Recombinant produced in E.Coli is a...
XAGE1A Human
Product Name : XAGE1A HumanDescription : XAGE1A Human Recombinant produced in E.Coli is a...
XAF1 Human
Product Name : XAF1 HumanDescription : XAF1 Human Recombinant produced in E.coli is a...
WWTR1 Human
Product Name : WWTR1 HumanDescription : WWTR1 Human Recombinant produced in E.coli is a...
WWC1 Human
Product Name : WWC1 HumanDescription : WWC1 Human Recombinant produced in E. coli is....
WLS Human
Product Name : WLS HumanDescription : WLS Human Recombinant produced in E.Coli is a...
WIF1 Mouse
Product Name : WIF1 MouseDescription : WIF1 produced in Sf9 Insect cells is a...
WIF1 Human
Product Name : WIF1 HumanDescription : WIF1 Human is a single, glycosylated polypeptide chain containing...
C1QBP Human
Product Name : C1qBP HumanDescription : C1qBP Human Recombinant produced in E.Coli is a...
WIBG Human
Product Name : WIBG HumanDescription : WIBG Recombinant Human produced in E.Coli is a...
WHSC2 Human
Product Name : WHSC2 HumanDescription : WHSC2 Human Recombinant fused with a 20 amino...
WFDC2 Human, His
Product Name : WFDC2 Human, HisDescription : WFDC2 Human Recombinant produced in E.Coli is...
WFDC2 Human
Product Name : WFDC2 HumanDescription : WAP Four-Disulfide Core Domain 2 Human Recombinant produced...
WFDC12 Human
Product Name : WFDC12 HumanDescription : WFDC12 Human Recombinant produced in E.coli is a...
WDR5 Human
Product Name : WDR5 HumanDescription : WDR5 Recombinant Human produced in E.Coli is a...
WBP2 Human
Product Name : WBP2 HumanDescription : WBP2 Human Recombinant produced in E. coli is...
VWA2 Human
Product Name : VWA2 HumanDescription : VWA2 Human Recombinant produced in E.Coli is a...
VTN Human
Product Name : VTN HumanDescription : VTN Human Recombinant produced in E.Coli is a...
VTI1B Human
Product Name : VTI1B HumanDescription : VTI1B Human Recombinant produced in E.Coli is a...
C1Q Rat
Product Name : C1q RatDescription : Rat Complement C1q produced in Rat plasma having...
VTCN1 Human, Sf9
Product Name : VTCN1 Human, Sf9Description : VTCN1 Human Recombinant produced in Sf9 Baculovirus...
VTCN1 Human
Product Name : VTCN1 HumanDescription : VTCN1 Human Recombinant produced in E.coli is a...
VTA1 Human
Product Name : VTA1 HumanDescription : VTA1 Human Recombinant produced in E.Coli is a...
VSTM2L Human
Product Name : VSTM2L HumanDescription : VSTM2L Human Recombinant produced in E.Coli is a...
VSNL1 Human, His
Product Name : VSNL1 Human, HisDescription : Visinin-Like Protein-1 Recombinant produced in E.Coli is...
VSNL1 Human
Product Name : VSNL1 HumanDescription : VSNL1 Human Recombinant produced in E.Coli is a...
VRK3 Human
Product Name : VRK3 HumanDescription : VRK3 Human Recombinant produced in E. coli is...
VPS4B Human
Product Name : VPS4B HumanDescription : VPS4B Human Recombinant produced in E.Coli is a...
VPS29 Mouse
Product Name : VPS29 MouseDescription : VPS29 Mouse Recombinant produced in E. coli is...
VPS29 Human
Product Name : VPS29 HumanDescription : VPS29 Human Recombinant produced in E. coli is...
C1Q Rabbit
Product Name : C1q RabbitDescription : Rabbit Complement C1q composed of 18 polypeptide chains...
VPS28 Human
Product Name : VPS28 HumanDescription : VPS28 Human Recombinant produced in E.Coli is a...
VPS26A Human
Product Name : VPS26A HumanDescription : VPS26A Human Recombinant produced in E.Coli is a...
VPS25 Human
Product Name : VPS25 HumanDescription : VPS25 Human Recombinant produced in E. coli is...
VPS24 Human
Product Name : VPS24 HumanDescription : VPS24 produced in E.Coli is a single, non-glycosylated...
VOPP1 Human
Product Name : VOPP1 HumanDescription : VOPP1 Human Recombinant fused with a 21 amino...
VNN1 Human
Product Name : VNN1 HumanDescription : VNN1 Human Recombinant produced in E.Coli is a...
VTN Human, Sf9
Product Name : VTN Human, Sf9Description : VTN produced in Sf9 Insect cells is...
Vimentin Human
Product Name : Vimentin HumanDescription : Vimentin Human Recombinant produced in E.coli cells is...
Vimentin Bovine
Product Name : Vimentin BovineDescription : Bovine Vimentin protein produced in Bovine Lens, having...
VHL Human
Product Name : VHL HumanDescription : Recombinant Human Von Hippel-Lindau Protein b-domain produced in...
C1Q Mouse
Product Name : C1q MouseDescription : Mouse Complement C1q produced in Mouse plasma having...
VCPKMT Human
Product Name : VCPKMT HumanDescription : VCPKMT Human Recombinant produced in E.Coli is a...
VCAM1 Mouse
Product Name : VCAM1 MouseDescription : VCAM1 Mouse Recombinant produced in Sf9 Baculovirus cells...
VCAM1 Human, sf9
Product Name : VCAM1 Human, sf9Description : VCAM1 produced in Sf9 Baculovirus cells is...
VCAM1 Human, HEK
Product Name : VCAM1 Human, HEKDescription : VCAM1 Human Recombinant produced by mammalian expression...
VCAM1 Human
Product Name : VCAM1 HumanDescription : VCAM1 Human Recombinant is expressed in E. coli...
VBP1 Human
Product Name : VBP1 HumanDescription : VBP1 Human Recombinant produced in E.Coli is a...
VAV1 Human
Product Name : VAV1 HumanDescription : VAV1 Human Recombinant produced in E.Coli is a...
VAT1 Human
Product Name : VAT1 HumanDescription : VAT1 Human Recombinant produced in E.Coli is a...
VASP Human
Product Name : VASP HumanDescription : VASP Human Recombinant fused with a 20 amino...
VAPB Human
Product Name : VAPB HumanDescription : VAPB Human Recombinant fused with a 20 amino...
C1q Human, Liquid
Product Name : C1q Human, LiquidDescription : Human Complement Component C1q produced in Human...
VAPA Human
Product Name : VAPA HumanDescription : VAPA Human Recombinant produced in E.Coli is a...
VAMP8 Human
Product Name : VAMP8 HumanDescription : VAMP8 Human Recombinant produced in E.Coli is a...
VAMP7 Human
Product Name : VAMP7 HumanDescription : VAMP7 Human Recombinant produced in E. coli is...
VAMP5 Human
Product Name : VAMP5 HumanDescription : VAMP5 produced in E.Coli is a single,non-glycosylated polypeptide...
VAMP4 Human
Product Name : VAMP4 HumanDescription : VAMP4 Human Recombinant produced in E.Coli is a...
VAMP3 Human
Product Name : VAMP3 HumanDescription : VAMP3 Human Recombinant produced in E.Coli is a...
VAMP2 Mouse
Product Name : VAMP2 MouseDescription : VAMP2 Mouse Recombinant produced in E.Coli is a...
VAMP2 Human
Product Name : VAMP2 HumanDescription : VAMP2 Human Recombinant produced in E.Coli is a...
VAMP1 Human
Product Name : VAMP1 HumanDescription : VAMP1 Human Recombinant produced in E.Coli is a...
UXT Human
Product Name : UXT HumanDescription : UXT Human Recombinant produced in E.Coli is a...
C1D Human
Product Name : C1D HumanDescription : C1D Human Recombinant produced in E. coli is...
UTP23 Human
Product Name : UTP23 HumanDescription : UTP23 Human Recombinant produced in E. coli is...
USP46 Human
Product Name : USP46 HumanDescription : USP46 Human Recombinant produced in E. coli is....
USP15 Human
Product Name : USP15 HumanDescription : USP15 Human Recombinant produced in E.coli is a...
USP14 Human
Product Name : USP14 HumanDescription : USP14 Human Recombinant produced in E.Coli is a...
USH1C Human
Product Name : USH1C HumanDescription : USH1C Human Recombinant fused with a 37 amino...
USF1 Human
Product Name : USF1 HumanDescription : USF1 Human Recombinant produced in E.Coli is a...
USE1 Human
Product Name : USE1 HumanDescription : USE1 Human Recombinant produced in E.Coli is a...
URM1 Human
Product Name : URM1 HumanDescription : URM1 produced in E.Coli is a single, non-glycosylated...
UQCRQ Human
Product Name : UQCRQ HumanDescription : UQCRQ Human Recombinant produced in E.coli is a...
UQCRH Human
Product Name : UQCRH HumanDescription : UQCRH Human Recombinant produced in E.Coli is a...
C19ORF80 Rat
Product Name : C19ORF80 RatDescription : C19ORF80 Rat Recombinant produced in E. coli is...
Agrin Rat
Product Name : Agrin RatDescription : Agrin Rat produced in Sf9 Baculovirus cells is...
UQCRC2 Human
Product Name : UQCRC2 HumanDescription : UQCRC2 Human Recombinant produced in E. coli is...
UQCRC1 Human
Product Name : UQCRC1 HumanDescription : UQCRC1 Human Recombinant produced in E.Coli is a...
UPK3A Human
Product Name : UPK3A HumanDescription : UPK3A Human Recombinant produced in E.Coli is a...
UPK2 Human
Product Name : UPK2 HumanDescription : UPK2 Human Recombinant produced in E.Coli is a...
UNC5B Rat
Product Name : UNC5B RatDescription : UNC5B Rat Recombinant produced in HEK293 is a...
UNC119B Human
Product Name : UNC119B HumanDescription : UNC119B Human Recombinant produced in E.coli is a...
ULBP4 Human
Product Name : ULBP4 HumanDescription : ULBP4 Human Recombinant produced in E.Coli is a...
ULBP3 Human
Product Name : ULBP3 HumanDescription : ULBP3 Human Recombinant produced in E.Coli is a...
ULBP3 Human, Sf9
Product Name : ULBP3 Human, Sf9Description : ULBP3 Human Recombinant produced in Sf9 Baculovirus...
ULBP2 Human, Sf9
Product Name : ULBP2 Human, Sf9Description : ULBP2 Human Recombinant produced in Sf9 Baculovirus...
C19ORF80 Mouse
Product Name : C19ORF80 MouseDescription : C19ORF80 Mouse Recombinant produced in E.Coli is a...
ULBP2 Human
Product Name : ULBP2 HumanDescription : ULBP2 Human Recombinant produced in E. coli is...
ULBP1 Human, Sf9
Product Name : ULBP1 Human, Sf9Description : ULBP1 Human Recombinant produced in Sf9 Baculovirus...
ULBP1 Human
Product Name : ULBP1 HumanDescription : ULBP1 Human Recombinant produced in E.coli is a...
UFSP1 Human
Product Name : UFSP1 HumanDescription : UFSP1 Human Recombinant produced in E.Coli is a...
UFM1 Human
Product Name : UFM1 HumanDescription : UFM1 Human Recombinant fused with a20 amino acid...
UFD1L Human
Product Name : UFD1L HumanDescription : UFD1L Human Recombinant produced in E.coli is a...
UCHL1 Mouse
Product Name : UCHL1 MouseDescription : UCHL1 Mouse Recombinant produced in E.Coli is a...
UCHL1 Human
Product Name : UCHL1 HumanDescription : UCHL1 Human Recombinant produced in E.Coli is a...
UCHL1 Mouse, Active
Product Name : UCHL1 Mouse, ActiveDescription : UCHL1 Mouse Recombinant produced in E.Coli is...
UBXN2B Human
Product Name : UBXN2B HumanDescription : UBXN2B Human Recombinant produced in E.coli is a...
C19ORF80 Human
Product Name : C19ORF80 HumanDescription : C19ORF80 Human Recombinant produced in E.Coli is a...
UBTD2 Human
Product Name : UBTD2 HumanDescription : UBTD2 Human Recombinant produced in E. coli is...
UBQLN2 Human
Product Name : UBQLN2 HumanDescription : UBQLN2 Human Recombinant produced in E.Coli is a...
UBLCP1 Human
Product Name : UBLCP1 HumanDescription : UBLCP1 Human Recombinant produced in E.Coli is a...
UBL5 Human
Product Name : UBL5 HumanDescription : UBL5 Human Recombinant produced in E.Coli is a...
UBL4A Human
Product Name : UBL4A HumanDescription : UBL4A Human Recombinant produced in E.Coli is a...
UBL3 Human
Product Name : UBL3 HumanDescription : UBL3 Human Recombinant produced in E.Coli is a...
Ubiquitin K48R Human
Product Name : Ubiquitin K48R HumanDescription : Recombinant human ubiquitin featuring a Lys 48...
Ubiquitin G76A Human
Product Name : Ubiquitin G76A HumanDescription : Recombinant human ubiquitin featuring a Gly76 to...
UBD Human
Product Name : UBD HumanDescription : UBD Human Recombinant produced in E.Coli is a...
U2AF1 Human
Product Name : U2AF1 HumanDescription : U2AF1 Human Recombinant produced in E.Coli is a...
C17ORF49 Human
Product Name : C17ORF49 HumanDescription : C17ORF49 Human Recombinant produced in E. coli is...
TYW5 Human
Product Name : TYW5 HumanDescription : TYW5 Human Recombinant produced in E.Coli is a...
TYRP1 Human
Product Name : TYRP1 HumanDescription : TYRP1 Human Recombinant produced in Sf9 Baculovirus cellsis...
TXNL4B Human
Product Name : TXNL4B HumanDescription : TXNL4B produced in E.Coli is a single, non-glycosylated...
TXNL4A Human
Product Name : TXNL4A HumanDescription : TXNL4A Human Recombinant produced in E. coli is...
TXNL1 Human
Product Name : TXNL1 HumanDescription : TXNL1 produced in E.Coli is a single, non-glycosylated...
TXNDC17 Human
Product Name : TXNDC17 HumanDescription : TXNDC17 Human Recombinant produced in E. coli is...
TXNDC12 Human
Product Name : TXNDC12 HumanDescription : TXNDC12 Human Recombinant produced in E. coli is...
TXN2 Human
Product Name : TXN2 HumanDescription : MTRX Recombinant produced in E.Coli is a single,...
TXN1 Human, His
Product Name : TXN1 Human, HisDescription : Thioredoxin Human Recombinant produced in E.Coli is...
TWF1 Human
Product Name : TWF1 HumanDescription : TWF1 Human Recombinant produced in E.Coli is a...
C17ORF103 Human
Product Name : C17ORF103 HumanDescription : C17ORF103 Human Recombinant produced in E.coli is a...
T.Vaginalis P65
Product Name : T.Vaginalis P65Description : The Recombinant Trichomonas vaginalis p65, E.Coli derived migrates...
TUSC2 Human
Product Name : TUSC2 HumanDescription : TUSC2 Human Recombinant produced in E.coli is a...
TULP1 Human
Product Name : TULP1 HumanDescription : TULP1 Human Recombinant produced in E. coli is...
TUBG1 Human, Sf9
Product Name : TUBG1 Human, Sf9Description : TUBG1 produced in Sf9 Insect cells is...
TUBG1 Human
Product Name : TUBG1 HumanDescription : TUBG1 Human Recombinant produced in E.Coli is a...
TUBB3 Human
Product Name : TUBB3 HumanDescription : TUBB3 Human Recombinant produced in E.Coli is a...
TTC33 Human
Product Name : TTC33 HumanDescription : TTC33 Human Recombinant produced in E. coli is...
TTC32 Human
Product Name : TTC32 HumanDescription : TTC32 Human Recombinant produced in E. coli is...
TTC1 Human
Product Name : TTC1 HumanDescription : TTC1 Human Recombinant produced in E.Coli is a...
TSSC4 Human
Product Name : TSSC4 HumanDescription : TSSC4 Human Recombinant produced in E.coli is a...
C16ORF53 Human
Product Name : C16ORF53 HumanDescription : C16ORF53 produced in E.Coli is a single, non-glycosylated...
TSR2 Human
Product Name : TSR2 HumanDescription : TSR2 Human Recombinant produced in E.Coli is a...
TSPAN7 Human
Product Name : TSPAN7 HumanDescription : TSPAN7 Human Recombinant produced in Sf9 Insect cells...
TSNAX Human
Product Name : TSNAX HumanDescription : TSNAX Human Recombinant produced in E.Coli is a...
TSN Human
Product Name : TSN HumanDescription : TSN produced in E.Coli is a single, non-glycosylated...
TSG101 Human
Product Name : TSG101 HumanDescription : TSG101 Human Recombinant produced in E.Coli is a...
TSFM Human
Product Name : TSFM HumanDescription : TSFM Human Recombinant produced in E.Coli is a...
TSC22D3 Human
Product Name : TSC22D3 HumanDescription : TSC22D3 Human Recombinant produced in E.Coli is a...
Trypsin Porcine
Product Name : Trypsin PorcineDescription : Recombinant Porcine Trypsin is expressed in E.coli and...
Trypsin-2 Human
Product Name : Trypsin-2 HumanDescription : Recombinant Human Trypsin-2 expressed in E.Coli having an...
Trypsin Bovine
Product Name : Trypsin BovineDescription : Recombinant Bovine Trypsin is free from any animal...
C14ORF129 Human
Product Name : C14ORF129 HumanDescription : C14ORF129 Human Recombinant fused with a 20 amino...
TXN2 Yeast
Product Name : TXN2 YeastDescription : Thioredoxin-2 Yeast Recombinant produced in E.Coli is a...
TROVE2 Human
Product Name : TROVE2 HumanDescription : RO-60 Human Recombinant produced in E.Coli is a...
TROVE2 His Human
Product Name : TROVE2 His HumanDescription : TROVE2 His is a recombinant protein having...
TROVE2 Bovine
Product Name : TROVE2 BovineDescription : TROVE2 is a natural protein having a molecular...
Troponin C-I-T Human
Product Name : Troponin C-I-T HumanDescription : Recombinant Human Cardiac Troponin C-I-T complex produced...
scIC2
Product Name : scIC2Description : Recombinant Single Chain Cardiac Troponin I-C 2nd generation produced...
Troponin C-I Human
Product Name : Troponin C-I HumanDescription : Recombinant Human Cardiac Troponin C-I complex produced...
Troponin-C2 Human
Product Name : Troponin-C2 HumanDescription : Troponin-C2 Human Recombinant produced in E.Coli is a...
TnT Human
Product Name : TnT HumanDescription : Human Cardiac Troponin T produced from Human Cardiac...
Troponin C-I-T Complex
Product Name : Troponin C-I-T ComplexDescription : Human Cardiac Troponin C-I-T Complex Protein produced...
C12ORF5 Human, His
Product Name : C12ORF5 Human, HisDescription : C12ORF5 Human Recombinant fused with a 24...
Troponin-C Human
Product Name : Troponin-C HumanDescription : Cardiac Troponin-C Human Recombinant produced in E.coli is...
Tpc1808 Rat
Product Name : Tpc1808 RatDescription : Tropic-1808Â Rat Recombinant protein fused to N-terminal His-Tag produced...
TRIP10 Human
Product Name : TRIP10 HumanDescription : TRIP10 Human Recombinant produced in E.coli is a...
TRIM33 Human
Product Name : TRIM33 HumanDescription : TRIM33 Human Recombinant produced in SF9 is a...
TRIM28 Human
Product Name : TRIM28 HumanDescription : TRIM28 Human Recombinant produced in E. coli is...
TRIM21 Human
Product Name : TRIM21 HumanDescription : TRIM21 Human Recombinant produced in SF9 is a...
TRIAP1 Human
Product Name : TRIAP1 HumanDescription : TRIAP1 Human Recombinant produced in E.Coli is a...
Tri a 14.0101
Product Name : Tri a 14.0101Description : Recombinant Non-Specific Lipid-Transfer Protein Tri a 14...
TREM2 Human
Product Name : TREM2 HumanDescription : TREM2 Human Recombinant produced in E.Coli is a...
TREM2 Human, HEK
Product Name : TREM2 Human, HEKDescription : TREM2 Human Recombinant is a single, glycosylated,...
C11ORF31 Human
Product Name : C11ORF31 HumanDescription : C11ORF31 Human Recombinant produced in E.coli is a...
TREM1 Human
Product Name : TREM1 HumanDescription : TREM1 Human Recombinant produced in E.Coli is a...
TRAPPC4 Human
Product Name : TRAPPC4 HumanDescription : TRAPPC4 Human Recombinant produced in E.coli is a...
TRAPPC3 Human
Product Name : TRAPPC3 HumanDescription : TRAPPC3 Human Recombinant produced in E. coli is...
TRAPPC2L Human
Product Name : TRAPPC2L HumanDescription : TRAPPC2L Human Recombinant produced in E. coli is...
TRAPPC2 Human
Product Name : TRAPPC2 HumanDescription : TRAPPC2 Human Recombinant produced in E.Coli is a...
TFRC Human, SF9
Product Name : TFRC Human, SF9Description : TFRC produced in Sf9 Baculovirus cells is...
TFRC Native
Product Name : TFRC NativeDescription : Human Transferrin Receptor Protein produced in human serum...
Transferrin Human, CHO
Product Name : Transferrin Human, CHODescription : Recombinant Human Transferrin produced in CHO cells...
TANK Human (1-119)
Product Name : TANK Human (1-119)Description : TANK produced in E.Coli is a single,...
TRAF1 Human
Product Name : TRAF1 HumanDescription : TRAF1 Human Recombinant produced in E.Coli is a...
C10ORF54 Mouse
Product Name : C10ORF54 MouseDescription : C10ORF54 produced in Sf9 Insect cells is a...
TPT1 Mouse
Product Name : TPT1 MouseDescription : TPT1 Mouse Recombinant produced in E.Coli is a...
TPT1 Human
Product Name : TPT1 HumanDescription : TPT1 Human Recombinant produced in E.Coli is a...
TPRKB Human
Product Name : TPRKB HumanDescription : TPRKB Human Recombinant produced E. coli is a...
TPPP Human
Product Name : TPPP HumanDescription : TPPP Human Recombinant produced in E.Coli is a...
TPPP3 Human
Product Name : TPPP3 HumanDescription : TPPP3 Human Recombinant produced in E.coli is a...
TPM4 Human
Product Name : TPM4 HumanDescription : TPM4 produced in E.Coli is a single, non-glycosylated...
TPM3 Human
Product Name : TPM3 HumanDescription : TPM3 Human Recombinant produced in E.Coli is a...
TPM2 Human
Product Name : TPM2 HumanDescription : TPM2 produced in E.Coli is a single, non-glycosylated...
TPM1 Human
Product Name : TPM1 HumanDescription : TPM1 Human Recombinant produced in E.Coli is a...
TPGS2 Human
Product Name : TPGS2 HumanDescription : TPGS2 Human Recombinant produced in E.coli is a...
C10ORF54 Human
Product Name : C10ORF54 HumanDescription : C10ORF54 Human Recombinant produced in Sf9 Baculoviruscells is...
AGR3 Human
Product Name : AGR3 HumanDescription : AGR3 produced in E.Coli is a single, non-glycosylated...
TPD52L1 Human
Product Name : TPD52L1 HumanDescription : TPD52L1 Human Recombinant His-Tag fusion protein produced in...
TP53AIP1 Human
Product Name : TP53AIP1 HumanDescription : TP53AIP1 Human Recombinant produced in E.coli is a...
TOR1A Human
Product Name : TOR1A HumanDescription : TOR1A Human Recombinant produced in E. coli is...
TOMM34 Human
Product Name : TOMM34 HumanDescription : TOMM34 Human Recombinant produced in E. coli is...
TOMM20 Human
Product Name : TOMM20 HumanDescription : TOMM20 Human Recombinant produced in E.coli is a...
TOM1L2 Human
Product Name : TOM1L2 HumanDescription : TOM1L2 HumanRecombinant produced in E.Coli is a single,...
TOLLIP Human
Product Name : TOLLIP HumanDescription : TOLLIP produced in E.Coli is a single, non-glycosylated...
TNNT3 Human
Product Name : TNNT3 HumanDescription : TNNT3 Human produced in E.Coli is a single,...
TNNT2 Human, His
Product Name : TNNT2 Human, HisDescription : TNNT2 Human Recombinant produced in E.Coli is...
TNNT1 Human
Product Name : TNNT1 HumanDescription : TNNT1 Human produced in E.Coli is a single,...
SERPING1 Human, Native
Product Name : SERPING1 Human, NativeDescription : Human Serpin Peptidase Inhibitor, Clade G Member...
TNNI3 Human, His
Product Name : TNNI3 Human, HisDescription : Recombinant Human TNNI3 protein produced in E.Coli...
TNNI3 Human
Product Name : TNNI3 HumanDescription : Recombinant Human TNNI3 produced in E.Coli is a...
TNNI3 Human Chimeric
Product Name : TNNI3 Human ChimericDescription : TNNI3 Human Chimeric produced in E.Coli is...
TNNI2 Human
Product Name : TNNI2 HumanDescription : Skeletal isoforms of Troponin I were suggested to...
TNNI2 Human, His
Product Name : TNNI2 Human, HisDescription : TNNI2 Human Recombinant produced in E. coli...
TNNI1 Human
Product Name : TNNI1 HumanDescription : TNNI1 Human Recombinant produced in E.Coli is a...
TNC Rabbit
Product Name : TNC RabbitDescription : Rabbit Skeletal Muscle Troponin-C is a single, glycosylated,...
TNIP1 Human
Product Name : TNIP1 HumanDescription : TNIP1 Human Recombinant fused with a 20 amino...
TMOD3 Human
Product Name : TMOD3 HumanDescription : TMOD3 Human Recombinant produced in E.Coli is a...
TMIGD2 Human
Product Name : TMIGD2 HumanDescription : TMIGD2 Human Recombinant is a single, glycosylated, polypeptide...
CRP Human Recombinant
Product Name : CRP Human RecombinantDescription : Recombinant Human CRP produced in E.Coli is...
TMEM27 Human
Product Name : TMEM27 HumanDescription : TMEM27 Human Recombinant produced in E.Coli is a...
TMEFF1 Human
Product Name : TMEFF1 HumanDescription : TMEFF1 Human Recombinant produced in E. coli is...
TMED10 Human
Product Name : TMED10 HumanDescription : TMED10 Human Recombinant produced in E.coli is a...
TLR3 Human
Product Name : TLR3 HumanDescription : TLR3 produced in Sf9 Baculovirus cells is a...
TLR2 Mouse
Product Name : TLR2 MouseDescription : TLR2 Mouse Recombinant produced in Sf9 Baculovirus cells...
TLR2 Human
Product Name : TLR2 HumanDescription : TLR2 Human Recombinant produced in Sf9 Baculovirus cells...
F3 Human
Product Name : F3 HumanDescription : Tissue factor Human Recombinant produced in E.Coli is...
TIRAP Human
Product Name : TIRAP HumanDescription : TIRAP Human Recombinant produced in E. coli is...
TIPIN Human
Product Name : TIPIN HumanDescription : TIPIN Human Recombinant produced in E.coli is a...
TINAGL1 Human, Sf9
Product Name : TINAGL1 Human, Sf9Description : TINAGL1 Human Recombinant produced in Sf9 Baculovirus...
CRP Human
Product Name : CRP HumanDescription : Human CRP produced in Human plasma having a...
TINAGL1 Human
Product Name : TINAGL1 HumanDescription : 800×600 TINAGL1 Human Recombinant produced in E.coli is...
TIMM8A Human
Product Name : TIMM8A HumanDescription : TIMM8A Human Recombinant produced in E.coli is a...
TIGIT Human
Product Name : TIGIT HumanDescription : TIGIT produced in Sf9 Baculovirus cells is a...
C12ORF5 Human, TAT
Product Name : C12ORF5 Human, TATDescription : TIGAR Human Recombinant produced in E.Coli is...
C12ORF5 Human
Product Name : C12ORF5 HumanDescription : TIGAR Human Recombinant produced in E.Coli is a...
TIFA Human
Product Name : TIFA HumanDescription : TIFA Human Recombinant produced in E.Coli is a...
TICAM2 Human
Product Name : TICAM2 HumanDescription : TICAM2 Human Recombinant produced in E.coli is a...
TIAL1 Human
Product Name : TIAL1 HumanDescription : TIAL1 Human Recombinant produced in E.Coli is a...
TIAF1 Human
Product Name : TIAF1 HumanDescription : TIAF1 Human Recombinant produced in E. coli is...
Thyroglobulin Human
Product Name : Thyroglobulin HumanDescription : Thyroglobulin Human produced in a mammalian cell line...
BUD31 Human
Product Name : BUD31 HumanDescription : BUD31 Human Recombinant produced in E.Coli is a...
THYN1 Human
Product Name : THYN1 HumanDescription : THYN1 produced in E.Coli is a single, non-glycosylated...
THRSP Human
Product Name : THRSP HumanDescription : THRSP Human Recombinant produced in E.Coli is a...
THOC7 Human
Product Name : THOC7 HumanDescription : THOC7 Human Recombinant produced in E.Coli is a...
TXN1 Human
Product Name : TXN1 HumanDescription : Thioredoxin Human Recombinant produced in E.Coli is a...
TXN1, His
Product Name : TXN1, HisDescription : Recombinant Thioredoxin produced in E.Coli is a single,...
TXN1 E.Coli
Product Name : TXN1 E.ColiDescription : Recombinant Thioredoxin was purified from E. coli harboring...
TXN Mouse
Product Name : TXN MouseDescription : TXN Mouse Recombinant produced in E.Coli is a...
THBS4 Mouse
Product Name : THBS4 MouseDescription : THBS4 Mouse Recombinant produced in HEK293 Cells is...
THBS1 Human
Product Name : THBS1 HumanDescription : Recombinant Human THBS1 is glycosylated with N-linked sugars...
THAP7 Human
Product Name : THAP7 HumanDescription : THAP7 Human Recombinant produced in E.Coli is a...
BUB3 Human
Product Name : BUB3 HumanDescription : BUB3 Human Recombinant produced in E.Coli is a...
THAP3 Human
Product Name : THAP3 HumanDescription : THAP3 Human Recombinant produced in E.coli is a...
THAP1 Human
Product Name : THAP1 HumanDescription : THAP1 Human Recombinant produced in E.Coli is a...
THAP11 Human
Product Name : THAP11 HumanDescription : THAP11 Human Recombinant produced in E.coli is a...
TGIF2LY Human
Product Name : TGIF2LY HumanDescription : TGIF2LY Human Recombinant produced in E. coli is....
TGIF2LX Human
Product Name : TGIF2LX HumanDescription : TGIF2LX Human Recombinant produced in E. coli is....
TGFBRAP1 Human
Product Name : TGFBRAP1 HumanDescription : TGFBRAP1 Human Recombinant produced in E.Coli is asingle,...
TGFBI Human, 182 a.a.
Product Name : TGFBI Human, 182 a.a.Description : TGFBI Recombinant Human produced in e.Coli...
TGFBI Human
Product Name : TGFBI HumanDescription : TGFBI Human Recombinant produced in e.Coli is a...
TFRC Human
Product Name : TFRC HumanDescription : TFRC Human Recombinant produced in E.Coli is a...
TFPI Human, Sf9
Product Name : TFPI Human, Sf9Description : TFPI Human Recombinant produced in Sf9 Baculovirus...
BTN3A1 Human
Product Name : BTN3A1 HumanDescription : BTN3A1 Human Recombinant produced in Sf9 Baculovirus cells...
TFPI Human
Product Name : TFPI HumanDescription : TFPI Human Recombinant produced in E.coli is a...
TFPI2 Human
Product Name : TFPI2 HumanDescription : TFPI2 Human Recombinant produced in Sf9 Baculovirus cells...
TFB2M Human
Product Name : TFB2M HumanDescription : TFB2M Human Recombinant produced in E.Coli is a...
TFB1M Human
Product Name : TFB1M HumanDescription : TFB1M Human Recombinant produced in E.Coli is a...
TFAM Human
Product Name : TFAM HumanDescription : TFAM produced in E.Coli is a single, non-glycosylated...
TES Human
Product Name : TES HumanDescription : TES Recombinant Human produced in E.Coli is a...
TEN1 Human
Product Name : TEN1 HumanDescription : TEN1 Human Recombinant produced in E. coli is...
TEF Human
Product Name : TEF HumanDescription : TEF Human Recombinant produced in E. coli is...
TCP1 Human
Product Name : TCP1 HumanDescription : TCP1 Human Recombinant fused with a 20 amino...
TCL1B Human
Product Name : TCL1B HumanDescription : TCL1B Human Recombinant produced in E.Coli is a...
BTLA Human
Product Name : BTLA HumanDescription : BTLA produced in Sf9 Insect cells is a...
TCL1A Human
Product Name : TCL1A HumanDescription : TCL1A Human Recombinant produced in E.Coli is a...
TCF4 Human, sf9
Product Name : TCF4 Human, sf9Description : TCF4 produced in Sf9 Baculovirus cells is...
TCF4 Human
Product Name : TCF4 HumanDescription : TCF4 Human Recombinant produced in E.coli is a...
ELOB Human
Product Name : ELOB HumanDescription : TCEB2 Human Recombinant produced in E.Coli is a...
TCEB1 Human
Product Name : TCEB1 HumanDescription : TCEB1 Human Recombinant produced in E.Coli is a...
TCEAL8 Human
Product Name : TCEAL8 HumanDescription : TCEAL8 Human Recombinant produced in E.Coli is a...
TCEAL7 Human
Product Name : TCEAL7 HumanDescription : TCEAL7 Human Recombinant produced in E. coli is...
TCEAL3 Human
Product Name : TCEAL3 HumanDescription : TCEAL3 Human Recombinant produced in E. coli is a...
TCEAL1 Human
Product Name : TCEAL1 HumanDescription : TCEAL1 Human Recombinant fused with an 8 amino...
TCEA2 Human
Product Name : TCEA2 HumanDescription : TCEA2 Human Recombinant produced in E.Coli is a...
BTLA Mouse
Product Name : BTLA MouseDescription : BTLA Mouse Recombinant produced in HEK293 Cells is...
TCEA1 Human
Product Name : TCEA1 HumanDescription : TCEA1 Human Recombinant produced in E. coli is...
TBPL1 Human
Product Name : TBPL1 HumanDescription : TBPL1 Human Recombinant produced in E.Coli is a...
tBID Mouse
Product Name : tBID MouseDescription : Truncated BID Mouse Recombinant also called BH3-interacting domain...
TBCEL Human
Product Name : TBCEL HumanDescription : TBCEL Recombinant Human produced in E.Coli is a...
TBCC Human
Product Name : TBCC HumanDescription : TBCC Human Recombinant produced in E. coli is...
TBCB Human
Product Name : TBCB HumanDescription : TBCB Human Recombinant produced in E. coli is a...
TBCA Human
Product Name : TBCA HumanDescription : TBCA Human Recombinant produced in E.Coli is a...
TBC1D22B Human
Product Name : TBC1D22B HumanDescription : TBC1D22B Human Recombinant produced in E.Coli is asingle,...
TBC1D1 Human
Product Name : TBC1D1 HumanDescription : TBC1D1 Human Recombinant produced in E.Coli is a...
TBC1D13 Human
Product Name : TBC1D13 HumanDescription : TBC1D13 Human Recombinant produced in E.coli is a...
BTF3L4 Human
Product Name : BTF3L4 HumanDescription : BTF3L4 Human Recombinant produced in E.Coli is a...
TAX1BP3 Human
Product Name : TAX1BP3 HumanDescription : TAX1BP3 Human Recombinant produced in E.Coli is a...
TATDN1 Human
Product Name : TATDN1 HumanDescription : TATDN1 Human Recombinant produced in E.Coli is a...
TARDBP Human
Product Name : TARDBP HumanDescription : TARDBP Human Recombinant produced in E.Coli is a...
TARDBP (1-414) Human, His
Product Name : TARDBP (1-414) Human, HisDescription : TARDBP Human Recombinant produced in E.Coli...
TARBP2 Human
Product Name : TARBP2 HumanDescription : TARBP2 Human Recombinant produced in E.Coli is a...
TANK Human
Product Name : TANK HumanDescription : TANK Human Recombinant produced in E.Coli is a...
TAGLN Human
Product Name : TAGLN HumanDescription : TAGLN Recombinant E.coli produced in E.Coli is a...
TAGLN3 Human
Product Name : TAGLN3 HumanDescription : TAGLN3 Human Recombinant produced in E.coli is a...
TAGLN2 Human
Product Name : TAGLN2 HumanDescription : TAGLN2 Human Recombinant fused with a 21 amino acid...
TAF15 Human
Product Name : TAF15 HumanDescription : TAF15 Human Recombinant produced in E. coli is....
BTF3 Human
Product Name : BTF3 HumanDescription : BTF3 Human Recombinant produced in E.Coli is a...
AGR2 Mouse
Product Name : AGR2 MouseDescription : AGR2 Mouse Recombinant produced in E.coli is a...
TADA3 Human
Product Name : TADA3 HumanDescription : TADA3 Human Recombinant produced in E.coli is a...
TACSTD2 Human, sf9
Product Name : TACSTD2 Human, sf9Description : TACSTD2 Human Recombinant produced in Sf9 Baculovirus...
TACSTD2 Human
Product Name : TACSTD2 HumanDescription : TACSTD2 Human Recombinant produced in E.Coli is a...
TACO1 Human
Product Name : TACO1 HumanDescription : TACO1 Human Recombinant produced in E.Coli is a...
TAC3 Human
Product Name : TAC3 HumanDescription : TAC3 Human Recombinant fused with 20 amino acid...
TAC1 Human
Product Name : TAC1 HumanDescription : TAC1 Human Recombinant produced in E.Coli is a...
SYT5 Human
Product Name : SYT5 HumanDescription : SYT5 Human Recombinant produced in E.Coli is a...
SYT4 Human
Product Name : SYT4 HumanDescription : SYT4 Human Recombinant produced in E.Coli is a...
SYT3 Human
Product Name : SYT3 HumanDescription : SYT3 Human Recombinant produced in E.coli is a...
SYT1 Human
Product Name : SYT1 HumanDescription : SYT1 produced in E.Coli is a single, non-glycosylated...
BSND Human
Product Name : BSND HumanDescription : BSND Human Recombinant produced in E.coli is a...
SYT13 Human
Product Name : SYT13 HumanDescription : SYT13 Human Recombinant produced in E.coli is a...
SYT11 Human
Product Name : SYT11 HumanDescription : SYT11 Human Recombinant produced in E.Coli is a...
SNCA E46K, Human
Product Name : SNCA E46K, HumanDescription : SNCA E46K Human Recombinant produced in E.Coli...
SYNJ2BP Human
Product Name : SYNJ2BP HumanDescription : SYNJ2BP Human Recombinant produced in E.Coli is a...
VAMP2 Human, (1-94)
Product Name : VAMP2 Human, (1-94)Description : VAMP2 Human Recombinant produced in e.coli is...
SYF2 Human
Product Name : SYF2 HumanDescription : SYF2 Human Recombinant produced in E.coli is a...
SYCE3 Human
Product Name : SYCE3 HumanDescription : SYCE3 Human Recombinant produced in E. coli is...
SVIP Human
Product Name : SVIP HumanDescription : SVIP Human Recombinant produced in E.coli is a...
SURF2 Human
Product Name : SURF2 HumanDescription : SURF2 Human Recombinant produced in E.coli is a...
SURF1 Human
Product Name : SURF1 HumanDescription : Surfeit-1 Human Recombinant produced in E.Coli is a...
BRMS1 Human
Product Name : BRMS1 HumanDescription : BRMS1 Human Recombinant produced in E.coli is a...
SUMO3 Human
Product Name : SUMO3 HumanDescription : SUMO3 produced in E.Coli is a single, non-glycosylated...
SUMO2 Human
Product Name : SUMO2 HumanDescription : SUMO2 Human Recombinant produced in E.Coli is a...
SUMO1 Human His
Product Name : SUMO1 Human HisDescription : SUMO1 Human Recombinant produced in E.coli is...
SUMO1 Human
Product Name : SUMO1 HumanDescription : The active human SUMO-I (the 1-97 animo acid...
SUGT1 Human
Product Name : SUGT1 HumanDescription : SGT1 produced in E.Coli is a single, non-glycosylated...
SUFU Human
Product Name : SUFU HumanDescription : SUFU Human Recombinant produced in E.Coli is a...
SUB1 Human
Product Name : SUB1 HumanDescription : SUB1 Human Recombinant produced in E.Coli is a...
STXBP6 Human
Product Name : STXBP6 HumanDescription : STXBP6 Human Recombinant produced in E.Coli is a...
STX6 Human
Product Name : STX6 HumanDescription : STX6 Human Recombinant produced in E.coli is a...
STX4 Human
Product Name : STX4 HumanDescription : STX4 Human Recombinant produced in E. coli is...
BRK1 Human
Product Name : BRK1 HumanDescription : BRK1 Human Recombinant produced in E.coli is a...
STX3 Human
Product Name : STX3 HumanDescription : STX3 Human Recombinant produced in E.Coli is a...
STX2 Human
Product Name : STX2 HumanDescription : STX2 Human Recombinant produced in E. coli is...
STX1A Human
Product Name : STX1A HumanDescription : Syntaxin-1A Human Recombinant fused to N-terminal His-Tag produced...
STX1A (1-265) Human
Product Name : STX1A (1-265) HumanDescription : STX1A Human Recombinant produced in E.Coli is...
STX17 Human
Product Name : STX17 HumanDescription : STX17 Human Recombinant produced in E.coli is a...
STX12 Human
Product Name : STX12 HumanDescription : STX12 Human Recombinant produced in E. coli is...
STX11 Human
Product Name : STX11 HumanDescription : STX11 Human Recombinant produced in E.Coli is a...
STUB1 Human
Product Name : STUB1 HumanDescription : STUB1 Human Recombinant produced in E.Coli is a...
Streptolysin-O
Product Name : Streptolysin-ODescription : Recombinant Streptococcus Pyogenes Streptolysin-O produced in E.coli is a...
Streptavidin
Product Name : StreptavidinDescription : Streptavidin Streptomyces Avidinii Recombinant produced in E.Coli. The molecular...
BRD3 Human
Product Name : BRD3 HumanDescription : BRD3 Human Recombinant produced in E.Coli is a...
Streptavidin-NC
Product Name : Streptavidin-NCDescription : Recombinant Streptavidin-NC produced in E.Coli is a single, non-glycosylated,...
Streptavidin, His
Product Name : Streptavidin, HisDescription : Recombinant Streptomyces Avidinii Streptavidin produced in E.Coli is...
Streptavidin (37-159), His
Product Name : Streptavidin (37-159), HisDescription : Streptavidin Recombinant produced in E. coli is...
Streptavidin Protein
Product Name : Streptavidin ProteinDescription : Streptavidin is a protein produced by Streptomyces avidinii...
STRADA Human
Product Name : STRADA HumanDescription : STRADA Human Recombinant produced in E.Coli is a...
STOML1 Human
Product Name : STOML1 HumanDescription : STOML1 Human Recombinant produced in E.Coli is a...
STOM Human
Product Name : STOM HumanDescription : STOM Human Recombinant produced in E. coli is...
STMN4 Human
Product Name : STMN4 HumanDescription : STMN4 Human Recombinant produced in E. coli is...
STMN3 Human
Product Name : STMN3 HumanDescription : STMN3 Recombinant Human produced in E.Coli is a...
STMN2 Human
Product Name : STMN2 HumanDescription : Recombinant Human Stathmin Like-2 produced in E.Coli is...
BRD2 Human
Product Name : BRD2 HumanDescription : BRD2 Human Recombinant produced in E.Coli is a...
STMN1 Human
Product Name : STMN1 HumanDescription : Recombinant Human Stathmin-1 produced in E.Coli is a...
STIP1 Mouse
Product Name : STIP1 MouseDescription : STIP1 Mouse Recombinant produced in E.coli is a...
STIP1 Human, His
Product Name : STIP1 Human, HisDescription : Recombinant Human STIP1 produced in E.Coli is...
STIM1 Human
Product Name : STIM1 HumanDescription : Recombinant STIM1 produced in E.Coli is a single,...
STEAP4 Human
Product Name : STEAP4 HumanDescription : STEAP4 Human Recombinant produced in E.Coli is a...
STBD1 Human
Product Name : STBD1 HumanDescription : STBD1 Human Recombinant produced in E.coli is a...
STARD5 Human
Product Name : STARD5 HumanDescription : STARD5 Human Recombinant produced in E.Coli is a...
STAR Human
Product Name : STAR HumanDescription : STAR Human Recombinant produced in E.coli is a...
STAP1 Human
Product Name : STAP1 HumanDescription : STAP1 Human Recombinant produced in E.Coli is a...
STAMBPL1 Human
Product Name : STAMBPL1 HumanDescription : STAMBPL1 Human Recombinant produced in E.coli is a...
BRD1 Human
Product Name : BRD1 HumanDescription : BRD1 Human Recombinant produced in E.Coli is a...
STAMBP Human
Product Name : STAMBP HumanDescription : STAMBP Human Recombinant produced in E.coli is a...
STAC Human
Product Name : STAC HumanDescription : STAC Human Recombinant produced in E.Coli is a...
ST13 Human
Product Name : ST13 HumanDescription : Recombinant Human ST13 produced in E.Coli is a...
SSX2 Human
Product Name : SSX2 HumanDescription : SSX2 Human Recombinant produced in E.Coli is a...
SSX1 Human
Product Name : SSX1 HumanDescription : SSX1 Human Recombinant produced in E.Coli is a...
SSSCA1 Human
Product Name : SSSCA1 HumanDescription : SSSCA1 Human Recombinant produced in E.Coli is a...
SSR4 Human
Product Name : SSR4 HumanDescription : SSR4 Human Recombinant produced in E.Coli is a...
SSR2 Human
Product Name : SSR2 HumanDescription : SSR2 Human Recombinant produced in E.Coli is a...
SSR1 Human
Product Name : SSR1 HumanDescription : SSR1 Human Recombinant produced in E.Coli is a...
SSBP1 Human, His
Product Name : SSBP1 Human, HisDescription : SSBP1 Human Recombinant produced in E.Coli is...
BPIFA1 Human
Product Name : BPIFA1 HumanDescription : BPIFA1 Human Recombinant produced in E.Coli is a...
SSBP1
Product Name : SSBP1Description : Recombinant Sulfolobus solfataricus Single-Stranded DNA Binding Protein 1 produced...
LA/SS-B Human, Biotin
Product Name : LA/SS-B Human, BiotinDescription : LA/SS-B Human Recombinant produced in SF9 is...
SRSF1 Human, Sf9
Product Name : SRSF1 Human, Sf9Description : SRSF1 Human Recombinant produced in Sf9 Baculovirus...
SRSF1 Human
Product Name : SRSF1 HumanDescription : SRSF1 Human Recombinant produced in E.coli is a...
SRP54 Human
Product Name : SRP54 HumanDescription : SRP54 is a full-length cDNA coding for the...
SRP19 Human
Product Name : SRP19 HumanDescription : SRP19 Human Recombinant fused with a 23 amino...
SRP14 Human
Product Name : SRP14 HumanDescription : SRP14 Human Recombinant fused with a 24 amino...
SRI Human
Product Name : SRI HumanDescription : SRI Human Recombinant fused with a 23 amino acid...
SRGN Human, HEK
Product Name : SRGN Human, HEKDescription : Serglycin Human Recombinant produced in HEK cells...
SRGN Human
Product Name : SRGN HumanDescription : SRGN Human Recombinant produced in E.coli is a...
BPI Human
Product Name : BPI HumanDescription : The native protein BPI is isolated from human...
sRAGE Human
Product Name : sRAGE HumanDescription : sRAGE Human Recombinant produced in E.Coli is a...
sRAGE Mouse
Product Name : sRAGE MouseDescription : sRAGE Mouse Recombinant produced in HEK cells is...
SRA1 Human
Product Name : SRA1 HumanDescription : SRA1 Human Recombinant produced in E.Coli is a...
SQSTM1 Human
Product Name : SQSTM1 HumanDescription : SQSTM1 Human Recombinant produced in E.Coli is a...
SPSB2 Human
Product Name : SPSB2 HumanDescription : SPSB2 Human Recombinant produced in E.Coli is a...
SPSB1 Human
Product Name : SPSB1 HumanDescription : SPSB1 produced in E.Coli is a single, non-glycosylated...
SPRY4 Human
Product Name : SPRY4 HumanDescription : SPRY4 Human Recombinant produced in E.coli is a...
SPRR1B Human
Product Name : SPRR1B HumanDescription : SPRR1B Human Recombinant produced in E.Coli is a...
SPRED1 Human
Product Name : SPRED1 HumanDescription : SPRED1 Human Recombinant produced in E. coli is...
SPOP Human
Product Name : SPOP HumanDescription : SPOP Human Recombinant fused with a 20 amino...
BOLA3 Human
Product Name : BOLA3 HumanDescription : BOLA3 Human Recombinant produced in E.Coli is a...
SPON1 Human
Product Name : SPON1 HumanDescription : SPON1 Human Recombinant produced in HEK293 cells is...
SPOCK3 Mouse
Product Name : SPOCK3 MouseDescription : SPOCK3 Mouse Recombinant produced in Sf9 Baculovirus cells...
SPINT2 Human, Sf9
Product Name : SPINT2 Human, Sf9Description : SPINT2 produced in Sf9 Baculovirus cells is...
SPINT2 Human
Product Name : SPINT2 HumanDescription : SPINT2 Human Recombinant produced in E.Coli is a...
SPINK7 Human
Product Name : SPINK7 HumanDescription : SPINK7 Human Recombinant produced in E.coli is a...
SPIN1 Human
Product Name : SPIN1 HumanDescription : SPIN1 Human Recombinant produced E. coli is a...
SPI1 Human
Product Name : SPI1 HumanDescription : SPI1 Human Recombinant produced in E. coli is...
SPG21 Human
Product Name : SPG21 HumanDescription : SPG21 produced in E.Coli is a single, non-glycosylated...
SPECC1 Human
Product Name : SPECC1 HumanDescription : SPECC1 Human Recombinant produced in E.Coli is a...
SPARCL1 Mouse
Product Name : SPARCL1 MouseDescription : SPARCL1 Mouse Recombinant produced in Sf9 Baculovirus cells...
BOLA1 Human
Product Name : BOLA1 HumanDescription : BOLA1 Human Recombinant produced in E.Coli is a...
AGR2 Human
Product Name : AGR2 HumanDescription : AGR2 Human Recombinant produced in E.Coli is a...
SPARC Human
Product Name : SPARC HumanDescription : Secreted Protein Acidic & Rich in Cysteine Human...
SPARC Mouse
Product Name : SPARC MouseDescription : SPARC Mouse Recombinant produced in Sf9 Baculovirus cells...
SPARC Human, Sf9
Product Name : SPARC Human, Sf9Description : SPARC Human Recombinant produced in Sf9 Baculovirus...
SPAG7 Human
Product Name : SPAG7 HumanDescription : SPAG7 Human Recombinant produced in E.Coli is a...
SPA Long
Product Name : SPA LongDescription : SPA Recombinant Long Form produced in E.Coli is...
SPA, His
Product Name : SPA, HisDescription : SPA Recombinant produced in E.Coli is a single...
SPA 33.4kDa
Product Name : SPA 33.4kDaDescription : SPA Recombinant produced in E.Coli is a homodimeric...
SPA17 Human
Product Name : SPA17 HumanDescription : SPA17 Human Recombinant produced in E. coli is...
SPA-Cys Long
Product Name : SPA-Cys LongDescription : SPA-Cys long Recombinant produced in E.Coli is a...
SPA-Cys His
Product Name : SPA-Cys HisDescription : SPA-Cys His Recombinant produced in E.Coli is a...
BNIP1 Human
Product Name : BNIP1 HumanDescription : BNIP1 Human Recombinant produced in E.Coli is a...
SPA-Cys
Product Name : SPA-CysDescription : SPA-Cys Recombinant produced in E.Coli is a single non-glycosylated...
SP100 Human
Product Name : SP100 HumanDescription : Recombinant Sp100Â antigen is a full-length cDNA coding having...
Soybean P34 GST
Product Name : Soybean P34 GSTDescription : The E.Coli derived GST Tag recombinant protein,...
Soybean P34
Product Name : Soybean P34Description : The E.Coli derived recombinant protein contains Soybean P34...
SOX2 Human, TAT
Product Name : SOX2 Human, TATDescription : Sox2 Human Recombinant produced in E.Coli is...
SOX2 Human, PolyR
Product Name : SOX2 Human, PolyRDescription : SOX2 Human Recombinant produced in E.Coli is...
SOX2 Human
Product Name : SOX2 HumanDescription : SOX2 Human Recombinant produced in E.Coli is a...
SOSTDC1 Human
Product Name : SOSTDC1 HumanDescription : SOSTDC1 Human Recombinant produced in E.Coli is a...
SOST Human, HEK
Product Name : SOST Human, HEKDescription : SOST Human Recombinant produced in HEK293 cells...
SOST Human
Product Name : SOST HumanDescription : SOST Human Recombinant produced in E.Coli is a...
B.Microti p32
Product Name : B.Microti p32Description : Recombinant Babesia Microti p32 produced in SF9 is...
SOS1 Human
Product Name : SOS1 HumanDescription : SOS1 produced in Sf9 Baculovirus cells is a...
SORBS3 Human
Product Name : SORBS3 HumanDescription : SORBS3 Human Recombinant produced in E.coli is a...
SODA E.Coli
Product Name : SODA E.ColiDescription : SODA produced in E.Coli is a single, non-glycosylated...
SOD Human His
Product Name : SOD Human HisDescription : SOD Human Recombinant produced in E.Coli is...
SOD Human
Product Name : SOD HumanDescription : Recombinant Human Cu/Zn Superoxide Dismutase produced in E.Coli...
SOD2 Mouse
Product Name : SOD2 MouseDescription : SOD2 Mouse Recombinant produced in E.Coli is a...
SOD2 Human
Product Name : SOD2 HumanDescription : SOD2 Human Recombinant produced in E.Coli is a...
SOD1 Human
Product Name : SOD1 HumanDescription : Recombinant Human Cu/Zn Superoxide Dismutase produced in E.Coli...
SOD Human, 15N
Product Name : SOD Human, 15NDescription : Recombinant Human Superoxide Dismutase, 15N produced in...
SOCS3 Human
Product Name : SOCS3 HumanDescription : SOCS3 Human Recombinant produced in E.Coli is a...
B.Microti IRA
Product Name : B.Microti IRADescription : Recombinant Babesia Microti IRA produced in SF9 is...
SNX5 Human
Product Name : SNX5 HumanDescription : SNX5 Human Recombinant produced in E.Coli is a...
SNX3 Human
Product Name : SNX3 HumanDescription : SNX3 produced in E.Coli is a single, non-glycosylated...
SNX1 Human
Product Name : SNX1 HumanDescription : SNX1 Human Recombinant produced in E.Coli is a...
SNURF Human
Product Name : SNURF HumanDescription : SNURF Human Recombinant produced in E.coli is a...
SNUPN Human
Product Name : SNUPN HumanDescription : SNUPN Recombinant Human produced in E.Coli is a...
SNTN Human
Product Name : SNTN HumanDescription : SNTN Human Recombinant fused with a 20 amino...
SNTA1 Human
Product Name : SNTA1 HumanDescription : SNTA1 Human Recombinant produced in E.Coli is a...
SNRPG Human
Product Name : SNRPG HumanDescription : SNRPG Human Recombinant fused with a 20 amino...
SNRPF Human
Product Name : SNRPF HumanDescription : SNRPF produced in E.Coli is a single, non-glycosylated...
SNRPE Human
Product Name : SNRPE HumanDescription : SNRPE Human Recombinant fused with a 20 amino acid...
BLOC1S2 Human
Product Name : BLOC1S2 HumanDescription : BLOC1S2 Human Recombinant produced in E. coli is a...
SNRPD Human
Product Name : SNRPD HumanDescription : SNRPD Human Recombinant produced in SF9 insect cells,...
Sm Bovine
Product Name : Sm BovineDescription : Bovine Small Nuclear Ribonucleoprotein Polypeptides purified from bovine...
SNRPD3 Human, Sf9
Product Name : SNRPD3 Human, Sf9Description : SNRPD3 Human Recombinant produced in SF9 is...
SNRPD3 Human
Product Name : SNRPD3 HumanDescription : SNRPD3 Human Recombinant produced in E.coli is a...
SNRPD2 Human, Sf9
Product Name : SNRPD2 Human, Sf9Description : SNRPD2 Human Recombinant produced in SF9 is...
SNRPD2 Human
Product Name : SNRPD2 HumanDescription : SNRPD2 Human Recombinant fused with a 20 amino...
SNRPD1 Human
Product Name : SNRPD1 HumanDescription : SNRPD1 Human Recombinant produced in SF9 is a...
SNRPC Human, Sf9
Product Name : SNRPC Human, Sf9Description : SNRPC Human Recombinant produced in SF9 is...
SNRPC Human
Product Name : SNRPC HumanDescription : SNRPC Human Recombinant produced in E.Coli is a...
SNRPB Human
Product Name : SNRPB HumanDescription : SNRPB Human Recombinant produced in SF9 is a...
BLNK Human
Product Name : BLNK HumanDescription : BLNK Human Recombinant fused with a 20 amino acid...
SNRPB2 Human
Product Name : SNRPB2 HumanDescription : SNRPB2 Human Recombinant fused with a 20 amino...
SNRPA Human
Product Name : SNRPA HumanDescription : SNRPA Human Recombinant produced in SF9 is a...
SNRPA1 Human
Product Name : SNRPA1 HumanDescription : SNRPA1 Human Recombinant produced in E.Coli is a...
SNRNP70 Human
Product Name : SNRNP70 HumanDescription : Recombinant Human U1-snRNP 68kDa cDNA codes for the...
SNRNP25 Human
Product Name : SNRNP25 HumanDescription : SNRNP25 produced in E.Coli is a single, non-glycosylated...
SNPH Human
Product Name : SNPH HumanDescription : SNPH Human Recombinant produced in E.Coli is a...
SNIP1 Human
Product Name : SNIP1 HumanDescription : SNIP1 Human Recombinant fused with a 21 amino...
SNF8 Human
Product Name : SNF8 HumanDescription : SNF8 Human Recombinant produced in E. coli is...
SNCG Mouse
Product Name : SNCG MouseDescription : SNCG Mouse Recombinant produced in E.Coli is a...
SNCG Human
Product Name : SNCG HumanDescription : g-Synuclein Human Recombinant produced in E.Coli is a...
BIRC7 Human, (1-280 a.a.)
Product Name : BIRC7 Human, (1-280 a.a.)Description : BIRC7 Human Recombinant produced in E.Coli...
SNCB Human
Product Name : SNCB HumanDescription : Recombinant Human b-Synuclein produced in E.Coli is a...
SNCA NACP112 Human
Product Name : SNCA NACP112 HumanDescription : A-Synuclein NACP112 Human Recombinant which is an alternatively...
SNCA Mouse
Product Name : SNCA MouseDescription : SNCA Recombinant Mouse produced in E.Coli is a...
SNCA Human
Product Name : SNCA HumanDescription : a-Synuclein Human Recombinant produced in E.Coli is a...
SNCA Delta-NAC Human
Product Name : SNCA Delta-NAC HumanDescription : A-Synuclein Delta-NAC Human Recombinant which is a deletion...
SNCA A53T Human
Product Name : SNCA A53T HumanDescription : A-Synuclein A53T Human Recombinant which is a Parkinson’s...
SNCA A30P Human
Product Name : SNCA A30P HumanDescription : A-Synuclein A30P Human Recombinant which is a Parkinson’s...
SNCA A30P/A53T Human
Product Name : SNCA A30P/A53T HumanDescription : A-Synuclein A30P/A53T Human Recombinant which is a Parkinson’s...
SNCA 96-140 Human
Product Name : SNCA 96-140 HumanDescription : A-Synuclein 96-140 Human Recombinant which is a deletion...
SNCA 61-140 Human
Product Name : SNCA 61-140 HumanDescription : A-Synuclein 61-140 Human Recombinant which is a deletion...
BIRC7 Human
Product Name : BIRC7 HumanDescription : BIRC7 Human Recombinant produced in E.Coli is a...
SNCA 1-60 Human
Product Name : SNCA 1-60 HumanDescription : A-Synuclein 1-60 Human Recombinant which is a deletion...
SNAPIN Human
Product Name : SNAPIN HumanDescription : SNAPIN Human Recombinant produced in E.Coli is a...
SNAPC1 Human
Product Name : SNAPC1 HumanDescription : SNAPC1 Human Recombinant produced in E.Coli is a...
SNAP25 Human
Product Name : SNAP25 HumanDescription : SNAP25 Human Recombinant produced in E.Coli is a...
SNAP25 Human, His
Product Name : SNAP25 Human, HisDescription : SNAP25 Human Recombinant fused to N-terminal His-Tag...
SNAP25 C.elegans
Product Name : SNAP25 C.elegansDescription : Recombinant C.elegans SNAP-25 produced in E.Coli is a...
SNAP23 Human
Product Name : SNAP23 HumanDescription : SNAP23 Human Recombinant produced in E.Coli is a...
SNAI2 Human
Product Name : SNAI2 HumanDescription : SNAI2 Human Recombinant produced in E.Coli is a...
SNAI1 Human
Product Name : SNAI1 HumanDescription : SNAI1 Human Recombinant produced in E.Coli is a...
SMNDC1 Human
Product Name : SMNDC1 HumanDescription : SMNDC1 produced in E.Coli is a single, non-glycosylated...
BIRC5 Human
Product Name : BIRC5 HumanDescription : Survivin Human Recombinant fused to a 152 a.a....
SMCP Human
Product Name : SMCP HumanDescription : SMCP Human Recombinant produced in E.Coli is a...
SMARCA4 Human
Product Name : SMARCA4 HumanDescription : SMARCA4 Human Recombinant produced in E.Coli is a...
SMAD4 Human
Product Name : SMAD4 HumanDescription : SMAD4 Human Recombinant produced in E.Coli is a...
SMAD3 Human
Product Name : SMAD3 HumanDescription : SMAD3 Human Recombinant produced in E.Coli is a...
SMAD2 Human
Product Name : SMAD2 HumanDescription : SMAD2 Human Recombinant produced in E.Coli is a...
SMAC/DIABLO Human
Product Name : SMAC/DIABLO HumanDescription : Smac/Diablo Human Recombinant fused to N-terminal T7-Tag produced...
SLURP1 Human Monomer
Product Name : SLURP1 Human MonomerDescription : SLURP1 Human Recombinant produced in E.Coli is...
SLURP1 Human Dimer
Product Name : SLURP1 Human DimerDescription : SLURP1 Human Recombinant produced in E.Coli is...
SLPI Human
Product Name : SLPI HumanDescription : SLPI Recombinant E.coli produced in E.Coli is a...
SLC51B Human
Product Name : SLC51B HumanDescription : SLC51B Human Recombinant produced in E.Coli is a...
BIN2 Human
Product Name : BIN2 HumanDescription : BIN2 produced in Sf9 Baculovirus cells is a...
SLC3A2 Human
Product Name : SLC3A2 HumanDescription : SLC3A2 produced in Sf9 Baculovirus cells is a...
SLAMF7 Human
Product Name : SLAMF7 HumanDescription : SLAMF7 produced in Sf9 Baculovirus cells is a...
SLAMF6 Human, sf9
Product Name : SLAMF6 Human, sf9Description : SLAMF6 Human Recombinant produced in Insect cells...
SLAMF6 Human
Product Name : SLAMF6 HumanDescription : SLAMF6 Human Recombinant produced in E.Coli is a...
SLAMF1 Human, Sf9
Product Name : SLAMF1 Human, Sf9Description : SLAMF1 Human Recombinant produced in Sf9 Baculovirus...
SLAMF1 Human
Product Name : SLAMF1 HumanDescription : SLAMF1 Human Recombinant produced in E.Coli is a...
SLA2 Human
Product Name : SLA2 HumanDescription : SLA2 Human Recombinant produced in E.Coli is a...
SKP E. Coli
Product Name : SKP E. ColiDescription : SKP Recombinant E.coli produced in E.Coli is...
SKA1 Human
Product Name : SKA1 HumanDescription : SKA1 Human Recombinant produced in E. coli is...
SIX6 Human
Product Name : SIX6 HumanDescription : SIX6 Human Recombinant produced in E.Coli is a...
BIN1 Human
Product Name : BIN1 HumanDescription : BIN1 Recombinant Human produced in E.Coli is a...
AGO2 Human
Product Name : AGO2 HumanDescription : AGO2 Human Recombinant produced in E.Coli is a...
SIX1 Human
Product Name : SIX1 HumanDescription : SIX1 Human Recombinant produced in E. coli is...
SIVA1 Human
Product Name : SIVA1 HumanDescription : SIVA1 Human Recombinant produced in E.Coli is a...
SIT1 Human
Product Name : SIT1 HumanDescription : SIT1 Human Recombinant produced in E.Coli is a...
SIRT6 Human
Product Name : SIRT6 HumanDescription : SIRT6 Human Recombinant produced in E.Coli is a...
SIRT5 Human
Product Name : SIRT5 HumanDescription : SIRT5 Human Recombinant produced in E.Coli is a...
SIRT3 Human
Product Name : SIRT3 HumanDescription : SIRT3 produced in E.Coli is a single, non-glycosylated...
SIRT2 Human
Product Name : SIRT2 HumanDescription : SIRT2 produced in E.Coli is a single, non-glycosylated...
SIRT1 Human
Product Name : SIRT1 HumanDescription : SIRT1 Human Recombinant produced in E.coli is a...
SIRPG Human, Sf9
Product Name : SIRPG Human, Sf9Description : SIRPG Human Recombinant produced in Sf9 Baculovirus...
SIRPG Human
Product Name : SIRPG HumanDescription : SIRPG Human Recombinant produced in E.Coli is a...
BGN Mouse
Product Name : BGN MouseDescription : BGN produced in Sf9 Insect cells is a...
SIRPB1 Human
Product Name : SIRPB1 HumanDescription : SIRPB1produced in Sf9 Baculovirus cells is a single,...
SIRPA Rat
Product Name : SIRPA RatDescription : SIRPA Rat Recombinant produced in Sf9 Baculovirus cellsis...
SIRPA Human
Product Name : SIRPA HumanDescription : SIRPA Human Recombinant produced in E.Coli is a...
SIL1 Human
Product Name : SIL1 HumanDescription : SIL1 Human Recombinant produced in E. coli is a...
SIKE1 Human
Product Name : SIKE1 HumanDescription : SIKE1 Human Recombinant produced in E.Coli is a...
SIGLEC9 Human
Product Name : SIGLEC9 HumanDescription : SIGLEC9 Human Recombinant produced in Sf9 Insect cells...
SIGLEC7 Human
Product Name : SIGLEC7 HumanDescription : SIGLEC7 Human Recombinant produced in Sf9 Baculovirus cells...
SIGLEC6 Human
Product Name : SIGLEC6 HumanDescription : SIGLEC6 Human Recombinant produced in Sf9 Baculovirus cells...
SIGLEC5 Human
Product Name : SIGLEC5 HumanDescription : SIGLEC5 Human Recombinant produced in Sf9 Baculovirus cells...
SIGLEC10 Human
Product Name : SIGLEC10 HumanDescription : SIGLEC10 Human produced in Sf9 Insect cells is...
BGN Human, Sf9
Product Name : BGN Human, Sf9Description : BGN produced in Sf9 Insect cells is...
SHFM1 Human
Product Name : SHFM1 HumanDescription : SHFM1 Human Recombinant produced in E.Coli is a...
SHC1 Human
Product Name : SHC1 HumanDescription : SHC1 Human Recombinant produced in E.coli is a...
SHBG Human
Product Name : SHBG HumanDescription : SHBG Human Recombinant produced in CHO cells is...
SH3GLB2 Human
Product Name : SH3GLB2 HumanDescription : SH3GLB2 Human Recombinant produced in E.Coli is a...
SH3GLB1 Human
Product Name : SH3GLB1 HumanDescription : SH3GLB1 Human Recombinant produced in E. coli is...
SH3GL3 Human
Product Name : SH3GL3 HumanDescription : SH3GL3 Human Recombinant produced in E.Coli is a...
SH3GL2 Human
Product Name : SH3GL2 HumanDescription : SH3GL2 Human Recombinant produced in E.Coli is a...
SH3BGRL Human
Product Name : SH3BGRL HumanDescription : SH3BGRL Human Recombinant produced in E.Coli is a...
SH3BGRL3 Human
Product Name : SH3BGRL3 HumanDescription : SH3BGRL3 Human Recombinant produced in E. coli is...
SH3BGRL2 Human
Product Name : SH3BGRL2 HumanDescription : SH3BGRL2 Human Recombinant produced in E. coli is...
BID Mouse, GST
Product Name : BID Mouse, GSTDescription : BID Mouse Recombinant produced in E.Coli is...
SH2D1B Human
Product Name : SH2D1B HumanDescription : SH2D1B Human Recombinant produced in Sf9 Baculovirus cells...
SH2D1A Human
Product Name : SH2D1A HumanDescription : SH2D1A Human Recombinant fused with a 20 amino...
SGTA Human
Product Name : SGTA HumanDescription : SGTA Human Recombinant produced in E.Coli is a...
SGCD Human
Product Name : SGCD HumanDescription : SGCD Human Recombinant produced in E.Coli is a...
SGCB Human
Product Name : SGCB HumanDescription : SGCB Human Recombinant produced in E.Coli is a...
SFTPD Human, Sf9
Product Name : SFTPD Human, Sf9Description : SFTPD produced in Sf9 Baculovirus cells is...
SFTPD Human
Product Name : SFTPD HumanDescription : SFTPD Human Recombinant produced in E.Coli is a...
SFTPB Human
Product Name : SFTPB HumanDescription : SFTPB Human Recombinant is a single, glycosylated polypeptide...
SFRP5 Human
Product Name : SFRP5 HumanDescription : SFRP5 Human Recombinant produced in E.Coli is a...
SFRP4 Human, sf9
Product Name : SFRP4 Human, sf9Description : SFRP4 produced in Sf9 Baculovirus cells is...
BID Mouse
Product Name : BID MouseDescription : BID Mouse Recombinant produced in E.Coli is a...
SFRP4 Human
Product Name : SFRP4 HumanDescription : SFRP4 Human Recombinant produced in HEK cells is...
SFRP2 Human
Product Name : SFRP2 HumanDescription : SFRP2 Human Recombinant produced in E.Coli is a...
SFRP2 Mouse
Product Name : SFRP2 MouseDescription : SFRP2 Mouse Recombinant produced in Sf9 Baculovirus cells...
SF3B14 Human
Product Name : SF3B14 HumanDescription : SF3B14 Human Recombinant fused with a 20 amino acid...
SF20 Mouse
Product Name : SF20 MouseDescription : Chromosome 19 Open Reading Frame 10 Mouse Recombinant...
SF20 Human
Product Name : SF20 HumanDescription : SF20 Human Recombinant produced in E.Coli is single,...
SET Human
Product Name : SET HumanDescription : SET Human Recombinant produced in E. coli is...
SERTAD2 Human
Product Name : SERTAD2 HumanDescription : SERTAD2 Human Recombinant produced in E.coli is a...
SERTAD1 Human
Product Name : SERTAD1 HumanDescription : SERTAD1 Human Recombinant produced in E.Coli is a...
SERPINI1 Human, His
Product Name : SERPINI1 Human, HisDescription : SERPINI1 Human Recombinant produced in E.Coli is...
BID Human
Product Name : BID HumanDescription : BID Human Recombinant produced in E.Coli is a...
SERPINI1 Human
Product Name : SERPINI1 HumanDescription : SERPINI1 Human Recombinant produced in E.coli is a...
SERPINH1 Human
Product Name : SERPINH1 HumanDescription : Recombinant Human HSP47 produced in E.Coli is a...
SERPING1 Human, Sf9
Product Name : SERPING1 Human, Sf9Description : SERPING1 produced in Sf9 Baculovirus cells is...
SERPING1 Human HEK
Product Name : SERPING1 Human HEKDescription : SERPING1 Human Recombinant produced by transfected human...
SERPING1 Human
Product Name : SERPING1 HumanDescription : SERPING1 Human Recombinant produced in E.Coli is a...
SERPINF2 Mouse
Product Name : SERPINF2 MouseDescription : SERPINF2 produced in Sf9 Baculovirus cells is a...
SERPINE1 Human
Product Name : SERPINE1 HumanDescription : SERPINE1 Human Recombinant fused to an N-terminal His-Tag...
SERPIND1 Human
Product Name : SERPIND1 HumanDescription : SERPIND1 Human Recombinant produced in E.coli is a...
SERPINC1 Human, Sf9
Product Name : SERPINC1 Human, Sf9Description : SERPINC Human Recombinant produced in Sf9 Baculovirus...
SERPINC1 Human
Product Name : SERPINC1 HumanDescription : SERPINC1 Human Recombinant produced in E.Coli is a...
BGN Human
Product Name : BGN HumanDescription : BGN Human Recombinant produced in E.Coli is a...
SERPINB8 Human
Product Name : SERPINB8 HumanDescription : SERPINB8 Human Recombinant produced in E.Coli is a...
SERPINB5 Human, His
Product Name : SERPINB5 Human, HisDescription : SERPINB5 Human Recombinant fused with a 20...
SERPINB4 Human
Product Name : SERPINB4 HumanDescription : SERPINB4 Human Recombinant produced in E.Coli is asingle,...
SERPINB3 Human
Product Name : SERPINB3 HumanDescription : SERPINB3 Human Recombinant produced in E.Coli is asingle,...
SERPINB2 Human, His
Product Name : SERPINB2 Human, HisDescription : SERPINB2 Human produced in E.Coli is a...
SERPINB2 Human
Product Name : SERPINB2 HumanDescription : SERPINB2 Human Recombinant produced in E.Coli is a...
SERPINA9 Mouse
Product Name : SERPINA9 MouseDescription : SERPINA9 Mouse Recombinant produced in Sf9 Baculovirus cells...
SERPINA8 Human
Product Name : SERPINA8 HumanDescription : SERPINA8 Human Recombinant produced in HEK cells is...
SERPINA7 Human
Product Name : SERPINA7 HumanDescription : Human Serpin Peptidase Inhibitor, Clade A Member 7...
SERPINA6 Human
Product Name : SERPINA6 HumanDescription : SERPINA6 Human Recombinant is a single, glycosylated polypeptide...
BEX1 Human
Product Name : BEX1 HumanDescription : BEX1 Human Recombinant produced in E. coli is...
SERPINA5 Human, Active
Product Name : SERPINA5 Human, ActiveDescription : SERPINA5 Human Recombinant produced in E.Coli is...
SERPINA5 Human
Product Name : SERPINA5 HumanDescription : SERPINA5 Human Recombinant fused with a 20 amino...
SERPINA4 Human
Product Name : SERPINA4 HumanDescription : SERPINA4 Human Recombinant produced in HEK cells is...
SERPINA3
Product Name : SERPINA3Description : SERPINA3 Human Recombinant fused with a 20 amino acid...
SERPINA3 Human
Product Name : SERPINA3 HumanDescription : Human Alpha-1 AntiChymotrypsin produced from normal human serum...
SERPINA1 Human
Product Name : SERPINA1 HumanDescription : SERPINA1 Human Recombinant produced in E.Coli is a...
SERPINA1 Human, Active
Product Name : SERPINA1 Human, ActiveDescription : SERPINA1 Human Recombinant produced in rice is...
SERPINA1
Product Name : SERPINA1Description : SERPINA1 extracted from human serum and having a 52kDa...
SERF2 Human
Product Name : SERF2 HumanDescription : SERF2 Human Recombinant produced in E.Coli is a...
SEPX1 Human
Product Name : SEPX1 HumanDescription : SEPX1 Human Recombinant fused with a 20 amino...
Bet v 1.0101
Product Name : Bet v 1.0101Description : Recombinant Major pollen allergen Bet v 1-A...
SEPW1 Human
Product Name : SEPW1 HumanDescription : SEPW1 Human Recombinant produced in E.Coli is a...
SEPT6 Human
Product Name : SEPT6 HumanDescription : SEPT6 Human Recombinant produced in E.coli is a...
SEPT5 Human
Product Name : SEPT5 HumanDescription : SEPT5 Human Recombinant produced in E.coli is a...
SEPT3 Human
Product Name : SEPT3 HumanDescription : SEPT3 Human Recombinant produced in E.Coli is a...
SEPT2 Human
Product Name : SEPT2 HumanDescription : SEPT2 Human Recombinant produced in E.Coli is a...
SEP15 Human
Product Name : SEP15 HumanDescription : SEP15 Human Recombinant produced in E.Coli is a...
SEMG1 Human
Product Name : SEMG1 HumanDescription : SEMG1 Human Recombinant produced in E. coli is...
SEMA7A Human
Product Name : SEMA7A HumanDescription : SEMA7A produced in Sf9 Insect cells is a...
SEMA3C Human
Product Name : SEMA3C HumanDescription : SEMA3C Human Recombinant produced in HEK cells is...
SELE Human, HEK
Product Name : SELE Human, HEKDescription : SELE Human Recombinant produced by mammalian expression...
BETV6.0102
Product Name : BETV6.0102Description : Recombinant BETV6.0102 produced in SF9 is a glycosylated, polypeptide...
SecB
Product Name : SecBDescription : Recombinant E.Coli SecB produced in E.Coli is a single,...
SEC61B Human
Product Name : SEC61B HumanDescription : SEC61B Human Recombinant produced in E.Coli is a...
SEC22B Human
Product Name : SEC22B HumanDescription : SEC22B Human Recombinant produced in E. coli is...
SEC13 Human
Product Name : SEC13 HumanDescription : SEC13 Human Recombinant fused with a 20 amino...
SDR16C5 Human
Product Name : SDR16C5 HumanDescription : SDR16C5 Human Recombinant produced in E.Coli is a...
SDHAF2 Human
Product Name : SDHAF2 HumanDescription : SDHAF2 Human Recombinant produced in E.Coli is a...
SDHAF1 Human
Product Name : SDHAF1 HumanDescription : SDHAF1 Human Recombinant produced in E.Coli is a...
SDCBP Human
Product Name : SDCBP HumanDescription : SDCBP produced in E.Coli is a single, non-glycosylated...
SDCBP2 Human
Product Name : SDCBP2 HumanDescription : SDCBP2 Human Recombinant produced in E.Coli is a...
SDC4 Human
Product Name : SDC4 HumanDescription : SDC4 Human Recombinant produced in E.Coli is a...
BETV4
Product Name : BETV4Description : Recombinant BETV4 produced in SF9 is a glycosylated, polypeptide...
Ag85B
Product Name : Ag85BDescription : Ag85B Recombinant His-Tag fusion protein produced in E.Coli is...
AAGAB Human
Product Name : AAGAB HumanDescription : AAGAB Human Recombinant produced in E.Coli is a...
SDC2 Human
Product Name : SDC2 HumanDescription : SDC2 Human Recombinant produced in Sf9 Baculovirus cells...
SDC1 Human
Product Name : SDC1 HumanDescription : SDC1 Human Recombinant produced in E. coli is...
SCRN1 Human
Product Name : SCRN1 HumanDescription : SCRN1 Human Recombinant produced in E.Coli is a...
SCP2D1 Human
Product Name : SCP2D1 HumanDescription : SCP2D1 Human Recombinant produced in E.Coli is a...
SCO2 Human
Product Name : SCO2 HumanDescription : SCO2 produced in E.Coli is a single, non-glycosylated...
SCO1 Human
Product Name : SCO1 HumanDescription : SCO1 Human Recombinant produced in E.Coli is a...
SCN3B Human, Sf9
Product Name : SCN3B Human, Sf9Description : SCN3B Human Recombinant produced in Sf9 Baculovirus...
SCN3B Human
Product Name : SCN3B HumanDescription : SCN3B Human Recombinant produced in E.coli is a...
SCGN Rat
Product Name : SCGN RatDescription : Secretagogin Rat Recombinant produced in E.Coli is a...
SCGN Human
Product Name : SCGN HumanDescription : SCGN Human Recombinant produced in E.Coli is a...
BP-1 Human
Product Name : BP-1 HumanDescription : BP-1 Human Recombinant (aa 103-168) expressed in E.coli,...
SCGB3A2 Human
Product Name : SCGB3A2 HumanDescription : SCGB3A2 Human Recombinant produced in E.Coli is a...
SCGB2A2 Human, HEK
Product Name : SCGB2A2 Human, HEKDescription : Mammaglobin-A Human Recombinant (Fc Chimera) produced in...
SCGB1D1 Human
Product Name : SCGB1D1 HumanDescription : SCGB1D1 Human Recombinant produced in E.Coli is a...
SCG5 Human
Product Name : SCG5 HumanDescription : SCG5 Human Recombinant produced in E.Coli is a...
SCG3 Human
Product Name : SCG3 HumanDescription : SCG3 Human Recombinant produced in E.coli is a...
SCAND1 Human
Product Name : SCAND1 HumanDescription : SCAND1 produced in E.Coli is a single, non-glycosylated...
SBDS Human
Product Name : SBDS HumanDescription : SBDS produced in E.Coli is a single, non-glycosylated...
SAR1B Human
Product Name : SAR1B HumanDescription : SAR1B Human Recombinant produced in E.Coli is a...
SAR1A Human
Product Name : SAR1A HumanDescription : SAR1A Human Recombinant fused with 20 amino acid...
SAP18 Human
Product Name : SAP18 HumanDescription : SAP18 Human Recombinant fused with 20 amino acid...
Bet v 2.0101
Product Name : Bet v 2.0101Description : Recombinant Profilin-1 produced in E.coli is a...
SAMSN1 Human
Product Name : SAMSN1 HumanDescription : SAMSN1 Human Recombinant produced in E.Coli is a...
SAMD13 Human
Product Name : SAMD13 HumanDescription : SAMD13 Human Recombinant produced in E.Coli is a...
S100Z Human
Product Name : S100Z HumanDescription : S100Z Recombinant Human produced in E.Coli is a...
S100P Human, His
Product Name : S100P Human, HisDescription : S100P Human Recombinant produced in E.Coli is...
S100P Human
Product Name : S100P HumanDescription : The Recombinant Human S100P has a molecular mass...
S100G Rat
Product Name : S100G RatDescription : CaBP9K is expressed with a -6xHis tag and...
S100G Human
Product Name : S100G HumanDescription : The Recombinant Human S100G produced in E.coli has...
s100bb Human
Product Name : s100bb HumanDescription : s100bb Human produced in Human brain tissue is...
s100bb Bovine
Product Name : s100bb BovineDescription : s100bb Bovine is suitable for use as a...
S100b Rhesus Macaque
Product Name : S100b Rhesus MacaqueDescription : S100B Rhesus Macaque Recombinant produced in E.Coli...
Bet v 1.0101, Sf9
Product Name : Bet v 1.0101, Sf9Description : Recombinant Major pollen allergen Bet v...
S100b Mouse, His
Product Name : S100b Mouse, HisDescription : S100B Mouse Recombinant produced in E.Coli is...
S100B Human, His
Product Name : S100B Human, HisDescription : S100B Human Recombinant produced in E.Coli is...
S100A9 Mouse
Product Name : S100A9 MouseDescription : S100A9 Mouse Recombinant produced in E.coli is a...
S100A9 Human
Product Name : S100A9 HumanDescription : S100A9 Human Recombinant produced in E.Coli is a...
S100A8 Mouse
Product Name : S100A8 MouseDescription : S100A8 Mouse Recombinant produced in E.Coli is a...
S100A8 Human, His
Product Name : S100A8 Human, HisDescription : The Recombinant Human S100A8 produced in E.coli...
S100A8 Human
Product Name : S100A8 HumanDescription : S100A8 Human Recombinant produced in E.Coli is a...
S100A8 Human, His-Myc
Product Name : S100A8 Human, His-MycDescription : S100A8 Human Recombinant produced in E.coli is...
S100A7A Human
Product Name : S100A7A HumanDescription : The S100A7A Human Recombinant is manufactured with N-terminal...
S100A7 Human
Product Name : S100A7 HumanDescription : S100A7 Human Recombinant produced in E.coli is a...
BEST1 Human
Product Name : BEST1 HumanDescription : BEST1 Human Recombinant produced in E.coli is a...
S100A6 Mouse
Product Name : S100A6 MouseDescription : S100A6 produced in E.Coli is a single, non-glycosylated...
S100A6 Human
Product Name : S100A6 HumanDescription : S100A6 Human Recombinant fused with a 20 amino acid...
S100A6 Murine
Product Name : S100A6 MurineDescription : S100A6 also called Calcyclin has been purified by...
S100A5 Mouse
Product Name : S100A5 MouseDescription : S100A5 Mouse Recombinant produced in E.coli is a...
S100A5 Human
Product Name : S100A5 HumanDescription : S100A5 Human Recombinant fused with a 20 amino acid...
S100A4 Mouse
Product Name : S100A4 MouseDescription : S100A4 Mouse Recombinant produced in E.Coli is a...
S100A4 Human
Product Name : S100A4 HumanDescription : S100A4 Human Recombinant produced in E.coli is a...
S100A3 Mouse
Product Name : S100A3 MouseDescription : S100A3 Mouse Recombinant produced in E.Coli is a...
S100A3 Human
Product Name : S100A3 HumanDescription : S100A3 Human Recombinant produced in E.coli is a...
S100A2 Human
Product Name : S100A2 HumanDescription : S100A2 Human Recombinant fused with a 20 amino acid...
BEND6 Human
Product Name : BEND6 HumanDescription : BEND6 Human Recombinant produced in E.Coli is a...
S100A1 Mouse
Product Name : S100A1 MouseDescription : S100A1 produced in E.Coli is a single, non-glycosylated...
S100A1 Human
Product Name : S100A1 HumanDescription : S100A1 Human Recombinant produced in E.Coli is a...
S100A16 Human
Product Name : S100A16 HumanDescription : S100A16 produced in E.Coli is a single, non-glycosylated...
S100A15 Mouse
Product Name : S100A15 MouseDescription : S100A15 Mouse Recombinant produced in E. coli is...
S100A14 Human
Product Name : S100A14 HumanDescription : S100A14 Human Recombinant fused with a 20 amino acid...
S100A13 Human
Product Name : S100A13 HumanDescription : S100A13 Human Recombinant produced in E.coli is a...
S100A12 Human
Product Name : S100A12 HumanDescription : The Recombinant Human S100A12 produced in E.coli has...
S100A11 Human
Product Name : S100A11 HumanDescription : S100A11 Human Recombinant is expressed in E. coli...
S100A10 Mouse
Product Name : S100A10 MouseDescription : S100A10 MouseRecombinant produced in E. coli is a...
S100A10 Human
Product Name : S100A10 HumanDescription : S100A10 Human Recombinant also called Calpactin light chain...
BECN1 Human
Product Name : BECN1 HumanDescription : BECN1 Human Recombinant produced in E.Coli is a...
RYBP Human
Product Name : RYBP HumanDescription : RYBP Human Recombinant produced in E. coli is...
RXRA Human
Product Name : RXRA HumanDescription : RXRA Human Recombinant produced in E.Coli is a...
RWDD4 Human
Product Name : RWDD4 HumanDescription : RWDD4 Human Recombinant produced in E.Coli is a...
RWDD1 Human
Product Name : RWDD1 HumanDescription : RWDD1 Human Recombinant produced in E.Coli is a...
RUVBL1 Human
Product Name : RUVBL1 HumanDescription : RUVBL1 Recombinant Human produced in E.Coli is a...
RUNX3 Human
Product Name : RUNX3 HumanDescription : RUNX3 Recombinant Human produced in E.Coli is a...
RTP4 Human
Product Name : RTP4 HumanDescription : RTP4 Human Recombinant produced in E.Coli is a...
RTN4R Human
Product Name : RTN4R HumanDescription : RTN4R produced in Sf9 Baculovirus cells is a...
RTN4IP1 Human
Product Name : RTN4IP1 HumanDescription : RTN4IP1 Human Recombinant produced in E.Coli is a...
RTCA Human
Product Name : RTCA HumanDescription : RTCA Human Recombinant produced in E.Coli is a...
Bcl XL Mouse
Product Name : Bcl XL MouseDescription : Bcl-XL Mouse Recombinant produced in E.Coli is...
RSU1 Human
Product Name : RSU1 HumanDescription : RSU1 Human Recombinant produced in E.coli is a...
RSPO3 Human
Product Name : RSPO3 HumanDescription : Recombinant Human R-Spondin-3 produced in HEK293 cells is...
RSPO1 Mouse
Product Name : RSPO1 MouseDescription : RSPO1 produced in Sf9 Baculovirus cells is a...
RSG1 Human
Product Name : RSG1 HumanDescription : RSG1 Human Recombinant produced in E.Coli is a...
RRAS Human
Product Name : RRAS HumanDescription : RRAS Human Recombinant produced in E.Coli is a...
RRAS2 Human
Product Name : RRAS2 HumanDescription : RRAS2 Human Recombinant fused with a 20 amino...
RRAGC Human
Product Name : RRAGC HumanDescription : RRAGC Human Recombinant produced in E.Coli is a...
RQCD1 Human
Product Name : RQCD1 HumanDescription : RQCD1 Human Recombinant fused with a 20 amino...
RPS7 Human
Product Name : RPS7 HumanDescription : RPS7 Human Recombinant produced in E.Coli is a...
RPS6KB1 Human
Product Name : RPS6KB1 HumanDescription : RPS6KB1 produced in Sf9 Baculovirus cells is a...
Bcl XL Human, His
Product Name : Bcl XL Human, HisDescription : Bcl-XL Human Recombinant produced in E.Coli...
RPS5 Human
Product Name : RPS5 HumanDescription : RPS5 Human Recombinant produced in E.Coli is a...
RPS4X Human
Product Name : RPS4X HumanDescription : RPS4X Human Recombinant produced in E. coli is...
RPS3A Human
Product Name : RPS3A HumanDescription : RPS3A Human Recombinant produced in E. coli is...
RPS3 Human
Product Name : RPS3 HumanDescription : RPS3 Human Recombinant produced in E.coli is a...
RPS2 Human
Product Name : RPS2 HumanDescription : RPS2 Human Recombinant produced in E.Coli is a...
RPS27A Human, Biotin
Product Name : RPS27A Human, BiotinDescription : Recombinant Human RPS27A protein biotinylated with NHS-biotin...
RPS27A Human
Product Name : RPS27A HumanDescription : Ubiquitin Human Recombinant expressed in E.coli and purified...
RPS24 Human
Product Name : RPS24 HumanDescription : RPS24 Human Recombinant produced in E.coli is a...
RPS20 Human
Product Name : RPS20 HumanDescription : RPS20 Human Recombinant produced in E. coli is....
RPS19 Human
Product Name : RPS19 HumanDescription : RPS19 Human Recombinant produced in E. coli is...
Bcl XL Human, GST
Product Name : Bcl XL Human, GSTDescription : Bcl-XL Human Recombinant produced in E.Coli...
RPS18 Human
Product Name : RPS18 HumanDescription : RPS18 Human Recombinant produced in E.Coli is a...
RPS16 Human
Product Name : RPS16 HumanDescription : RPS16 Human Recombinant produced in E.coli is a...
RPS14 Human
Product Name : RPS14 HumanDescription : RPS14 Human Recombinant fused with a 23 amino acid...
RPS13 Human
Product Name : RPS13 HumanDescription : RPS13 Human Recombinant produced in E.Coli is a...
RPS12 Human
Product Name : RPS12 HumanDescription : 800×600 RPS12 Human Recombinant produced in E.Coli is...
RPS10 Human
Product Name : RPS10 HumanDescription : RPS10 Human Recombinant produced in E.Coli is a...
RPRD1B Human
Product Name : RPRD1B HumanDescription : RPRD1B Human Recombinant produced in E.Coli is a...
RPRD1A Human
Product Name : RPRD1A HumanDescription : RPRD1A Human Recombinant produced in E.coli is a...
RPLP2 Human
Product Name : RPLP2 HumanDescription : RPLP2 Human Recombinant produced in E.Coli is a...
RPLP1 Human
Product Name : RPLP1 HumanDescription : RPLP1 is a full-length cDNA coding for the...
Bcl XL Human
Product Name : Bcl XL HumanDescription : Bcl-XL Human Recombinant produced in E.Coli is...
Ag85A
Product Name : Ag85ADescription : Recombinant Mycobacterium tuberculosis Ag85A (43-338 a.a) produced in Hi-5...
RPLP0 Human
Product Name : RPLP0 HumanDescription : Ribosomal Phosphoprotein P0 Human Recombinant produced in SF9...
RPL8 Human
Product Name : RPL8 HumanDescription : RPL8 Human Recombinant produced in E.Coli is a...
RPL7A Human
Product Name : RPL7A HumanDescription : RPL7A Human Recombinant produced in E.Coli is a...
RPL5 Human
Product Name : RPL5 HumanDescription : RPL5 Human Recombinant produced in E.Coli is a...
RPL35A Human
Product Name : RPL35A HumanDescription : RPL35A Human Recombinant produced in E.coli is a...
RPL35 Human
Product Name : RPL35 HumanDescription : RPL35 Human Recombinant produced in E.Coli is a...
RPL34 Human
Product Name : RPL34 HumanDescription : RPL34 Human Recombinant produced in E.coli is a...
RPL31 Human
Product Name : RPL31 HumanDescription : RPL31 Human Recombinant produced in E.Coli is a...
RPL30 Human
Product Name : RPL30 HumanDescription : RPL30 Human Recombinant produced in E.Coli is a...
RPL26L1 Human
Product Name : RPL26L1 HumanDescription : RPL26L1 Human Recombinant produced in E. coli is...
BCL7C Human
Product Name : BCL7C HumanDescription : BCL7C Human Recombinant produced in E.Coli is a...
RPL26 Human
Product Name : RPL26 HumanDescription : RPL26 Human Recombinant produced in E. coli is...
RPL23A Human
Product Name : RPL23A HumanDescription : RPL23A Human Recombinant produced in E.Coli is a...
RPL22 Human
Product Name : RPL22 HumanDescription : RPL22 Human Recombinant produced in E.coli is a...
RPL18A Human
Product Name : RPL18A HumanDescription : RPL18A Human Recombinant produced in E.coli is a...
RPL12 Human
Product Name : RPL12 HumanDescription : RPL12 Human Recombinant produced in E.Coli is a...
RPL11 Human
Product Name : RPL11 HumanDescription : RPL11 Human Recombinant produced in E.coli is a...
RPAIN Human
Product Name : RPAIN HumanDescription : RPAIN Human Recombinant produced in E.Coli is a...
RPA2 Human
Product Name : RPA2 HumanDescription : RPA2 Human Recombinant fused with a 23 amino...
RP9 Human
Product Name : RP9 HumanDescription : RP9 Human Recombinant produced in E.Coli is a...
ROBLD3 Human
Product Name : ROBLD3 HumanDescription : ROBLD3 Human Recombinant fused with a 24 amino...
BCL7A Human
Product Name : BCL7A HumanDescription : BCL7A Human Recombinant produced in E.Coli is a...
TROVE2 Human, His Biotin
Product Name : TROVE2 Human, His BiotinDescription : TROVE2 Human Recombinant Biotin produced in...
TROVE2 Bovine, Biotin
Product Name : TROVE2 Bovine, BiotinDescription : TROVE2 is a biotinlyated natural protein having...
TRIM21 Human Biotin
Product Name : TRIM21 Human BiotinDescription : TRIM21 Human Recombinant, Biotin produced in SF9...
RNP/Sm Bovine
Product Name : RNP/Sm BovineDescription : RNP/Sm Bovine is purified from bovine tissues by...
RNF7 Human
Product Name : RNF7 HumanDescription : RNF7 Human Recombinant produced in E.Coli is a...
RNF4 Human
Product Name : RNF4 HumanDescription : RNF4 Human Recombinant produced in E.Coli is a...
RNF34 Human
Product Name : RNF34 HumanDescription : RNF34 Human Recombinant produced in E.Coli is a...
RNF181 Human
Product Name : RNF181 HumanDescription : RNF181 Human Recombinant produced in E. coli is...
RNF114 Human
Product Name : RNF114 HumanDescription : RNF114 Human Recombinant produced in E.Coli is a...
RND3 Human
Product Name : RND3 HumanDescription : RND3 Recombinant Human produced in E.Coli is a...
BCL2L2 Human, His
Product Name : BCL2L2 Human, HisDescription : BCL2L2 Human Recombinant produced in E.Coli is...
RND1 Human
Product Name : RND1 HumanDescription : RND1 Human Recombinant produced in E.coli is a...
RLN3 Human
Product Name : RLN3 HumanDescription : Relaxin-3 Human Recombinant produced in E.Coli is a...
RLN2 Human, Sf9
Product Name : RLN2 Human, Sf9Description : RLN2 Human Recombinant produced in Sf9 Baculovirus...
RLN2 Human
Product Name : RLN2 HumanDescription : RLN2 Human Recombinant produced in E.Coli is a...
RLBP1 Human, sf9
Product Name : RLBP1 Human, sf9Description : RLBP1 Human Recombinant produced in Sf9 Baculovirus...
RLBP1 Human
Product Name : RLBP1 HumanDescription : RLBP1 Human Recombinant produced in E.coli is a...
RHOV Human
Product Name : RHOV HumanDescription : RHOV Human Recombinant produced in E. coli is...
RHOQ Human
Product Name : RHOQ HumanDescription : RHOQ Human Recombinant produced in E.Coli is a...
RHOG Human
Product Name : RHOG HumanDescription : RHOG Human Recombinant produced in E. coli is...
RHOD Human
Product Name : RHOD HumanDescription : RHOD produced in E.Coli is a single, non-glycosylated...
BCL2L1 Mouse
Product Name : BCL2L1 MouseDescription : BCL2L1 Mouse Recombinant produced in E.Coli is a...
RHOC Human
Product Name : RHOC HumanDescription : RHOC Recombinant Human produced in E.Coli is a...
RHOB Human
Product Name : RHOB HumanDescription : RHOB produced in E.Coli is a single, non-glycosylated...
RHOA Human
Product Name : RHOA HumanDescription : RHOA Human Recombinant fused with a 37 amino...
RHEB Human
Product Name : RHEB HumanDescription : RHEB Human Recombinant produced in E.Coli is a...
RGS5 Human
Product Name : RGS5 HumanDescription : RGS5 Human Recombinant produced in E.Coli is a...
RGS4 Human
Product Name : RGS4 HumanDescription : RGS4 Human Recombinant produced in E.Coli is a...
RGS2 Human
Product Name : RGS2 HumanDescription : RGS2 produced in E.Coli is a single, non-glycosylated...
RGS21 Human
Product Name : RGS21 HumanDescription : RGS21 Human Recombinant produced in E.Coli is a...
RGS1 Human
Product Name : RGS1 HumanDescription : RGS1 Human Recombinant produced in E.Coli is a...
RGS19 Human
Product Name : RGS19 HumanDescription : RGS19 produced in E.Coli is a single, non-glycosylated...
BCL2L11 Human
Product Name : BCL2L11 HumanDescription : BCL2L11 Human Recombinant produced in E.Coli is a...
RGS17 Human
Product Name : RGS17 HumanDescription : RGS17 Human Recombinant produced in E.coli is a...
RGS16 Human
Product Name : RGS16 HumanDescription : RGS16 Human Recombinant produced in E.Coli is a...
RGS14 Human
Product Name : RGS14 HumanDescription : RGS14 Human Recombinant produced in E.Coli is a...
RGS10 Human
Product Name : RGS10 HumanDescription : RGS10 Human Recombinant produced in E.coli is a...
RGN Human
Product Name : RGN HumanDescription : RGN Human Recombinant produced in E.Coli is a...
rGFP
Product Name : rGFPDescription : rGFP Aequorea victoria produced in E.Coli is a single,...
RFXANK Human
Product Name : RFXANK HumanDescription : RFXANK Human Recombinant produced in E. coli is...
RERG Human
Product Name : RERG HumanDescription : RERG Human Recombinant fused with a 20 amino acid...
REN Mouse
Product Name : REN MouseDescription : REN produced in Sf9 Baculovirus cells is a...
REN Human, sf9
Product Name : REN Human, sf9Description : REN Human Recombinant produced in Sf9 Baculovirus...
BCL2L10 Human
Product Name : BCL2L10 HumanDescription : BCL2L10 Human Recombinant produced in E.Coli is a...
REN Human, HEK
Product Name : REN Human, HEKDescription : Renin Human Recombinant produced in HEK cells...
REN Human
Product Name : REN HumanDescription : REN Human Recombinant produced in E. coli is...
REG4 Human, Sf9
Product Name : REG4 Human, Sf9Description : REG4 produced in Sf9 Baculovirus cells is...
REG4 Human
Product Name : REG4 HumanDescription : The Recombinant Human REG-4 is manufactured with N-terminal...
REG3A Human
Product Name : REG3A HumanDescription : The Recombinant Human REG3A protein is produced with...
REG1B Human
Product Name : REG1B HumanDescription : The Recombinant Human REG 1 beta manufactured with...
REG1A Human
Product Name : REG1A HumanDescription : The Recombinant Human REG 1 alpha is produced...
RCVRN Mouse
Product Name : RCVRN MouseDescription : Recoverin Mouse Recombinant produced in E.Coli is a...
RAP Rat
Product Name : RAP RatDescription : Recombinant Rat Receptor Associated Protein produced inE.Coli is...
RDBP Human
Product Name : RDBP HumanDescription : RDBP produced in E.Coli is a single, non-glycosylated...
BCL2A1 Human
Product Name : BCL2A1 HumanDescription : BCL2A1 Human Recombinant produced in E. coli is...
Recoverin Human
Product Name : Recoverin HumanDescription : Recoverin Human Recombinant produced in E.Coli is a...
RCN3 Human
Product Name : RCN3 HumanDescription : RCN3 Human Recombinant produced in E.Coli is a...
RCN2 Human
Product Name : RCN2 HumanDescription : RCN2 produced in E.Coli is a single, non-glycosylated...
RCN1 Human
Product Name : RCN1 HumanDescription : RCN1 Recombinant Human produced in E.Coli is a...
RCHY1 Human
Product Name : RCHY1 HumanDescription : RCHY1 Human Recombinant produced in E. coli is...
RCAN3 Human
Product Name : RCAN3 HumanDescription : RCAN3 Human Recombinant produced in E. coli is...
RCAN2 Human
Product Name : RCAN2 HumanDescription : RCAN2 Human Recombinant produced in E.Coli is a...
RCAN1 Human
Product Name : RCAN1 HumanDescription : RCAN1 Isoform-b Human Recombinant produced in E.Coli is...
RBM8A Human
Product Name : RBM8A HumanDescription : RBM8A produced in E.Coli is a single, non-glycosylated...
RBM3 Human
Product Name : RBM3 HumanDescription : RBM3 Human Recombinant produced in E.Coli is a...
BMF Human
Product Name : BMF HumanDescription : Bcl2 modifying factor Human Recombinant produced in E.Coli...
RBM18 Human
Product Name : RBM18 HumanDescription : RBM18 Human Recombinant produced in E.Coli is a...
RBM17 Human
Product Name : RBM17 HumanDescription : RBM17 Human Recombinant produced in E.Coli is a...
RBM11 Human
Product Name : RBM11 HumanDescription : RBM11 Human Recombinant produced in E. coli is...
RBBP9 Human
Product Name : RBBP9 HumanDescription : RBBP9 Human Recombinant produced in E.Coli is a...
RBBP4 Human
Product Name : RBBP4 HumanDescription : RBBP4 Human Recombinant produced in E.Coli is a...
RB1 Human
Product Name : RB1 HumanDescription : Retinoblastoma Human Recombinant fused with 6X His tag...
RASSF3 Human
Product Name : RASSF3 HumanDescription : RASSF3 Human Recombinant produced in E.Coli is a...
RASSF1A Human
Product Name : RASSF1A HumanDescription : RASSF1A Human Recombinant produced in E.Coli is a...
RASL12 Human
Product Name : RASL12 HumanDescription : RASL12 Human Recombinant produced in E.Coli is a...
RASD2 Human
Product Name : RASD2 HumanDescription : RASD2 Human Recombinant produced in E.Coli is a...
BCL2 Human, His
Product Name : BCL2 Human, HisDescription : BCL2 Human Recombinant produced in E.Coli is...
RARRES2 Human, Sf9
Product Name : RARRES2 Human, Sf9Description : RARRES2 produced in Sf9 Baculovirus cells is...
RARRES2 Human, His
Product Name : RARRES2 Human, HisDescription : RARRES2 Human Recombinant produced in E.Coli is...
RARRES2 Human
Product Name : RARRES2 HumanDescription : RARRES2 Human Recombinant produced in E.Coli is a...
RARRES1 Human
Product Name : RARRES1 HumanDescription : RARRES1 Human Recombinant produced in E.coli is a...
RARA Human
Product Name : RARA HumanDescription : RARA Human Recombinant produced in E.Coli is a...
RAPSN Mouse
Product Name : RAPSN MouseDescription : RAPSN Mouse Recombinant produced in E.Coli is a...
RAP2B Human
Product Name : RAP2B HumanDescription : RAP2B Human Recombinant produced in E.Coli is a...
RAP2A Human
Product Name : RAP2A HumanDescription : RAP2A Human Recombinant fused with a 20 amino...
RAP1B Human
Product Name : RAP1B HumanDescription : RAP1B produced in E.Coli is a single, non-glycosylated...
RAP1A Human
Product Name : RAP1A HumanDescription : RAP1A Recombinant E.coli produced in E.Coli is a...
Bcl 2 Human (minus NWGR domain)
Product Name : Bcl 2 Human (minus NWGR domain)Description : Bcl-2 Des NWGR domain...
AFP Protein
Product Name : AFP ProteinDescription : AFP produced in Sf9 Baculovirus cells is a...
RANGRF Human
Product Name : RANGRF HumanDescription : RANGRF Human Recombinant produced in E.Coli is a...
RANBP3 Human
Product Name : RANBP3 HumanDescription : RANBP3 Human Recombinant produced in E.Coli is a...
RANBP1 Human
Product Name : RANBP1 HumanDescription : RANBP1 Human Recombinant produced in E. coli is a...
RAN Human
Product Name : RAN HumanDescription : RAN Recombinant Human produced in E.Coli is a single,...
RAMP3 Human
Product Name : RAMP3 HumanDescription : RAMP3 Human Recombinant produced in E.Coli is a...
RAMP1 Human
Product Name : RAMP1 HumanDescription : RAMP1 Human Recombinant produced in E.coli is a...
RALY Human
Product Name : RALY HumanDescription : RALY Human Recombinant produced in E.Coli is a...
RALB Human
Product Name : RALB HumanDescription : RALB Human Recombinant fused with a 24 amino...
RALA Mouse
Product Name : RALA MouseDescription : RALA Mouse Recombinant produced in E.Coli is a...
RALA Human
Product Name : RALA HumanDescription : RALA Human Recombinant fused with a 24 amino...
Bcl 2 Human (minus BH4 domain)
Product Name : Bcl 2 Human (minus BH4 domain)Description : Bcl-2 Des BH4 domain...
RAGE Human, Sf9
Product Name : RAGE Human, Sf9Description : RAGE Human Recombinant produced in Sf9 Baculovirus...
RAET1L Human
Product Name : RAET1L HumanDescription : RAET1L Human Recombinant produced in Sf9 Baculovirus cells...
RAET1G Human
Product Name : RAET1G HumanDescription : RAET1G Human Recombinant produced in E.Coli is a...
RAET1E Human, Sf9
Product Name : RAET1E Human, Sf9Description : RAET1E Human Recombinant produced in Sf9 Insect...
RAET1E Mouse
Product Name : RAET1E MouseDescription : RAET1E produced in Sf9 Insect cells is a...
RAET1E Human
Product Name : RAET1E HumanDescription : RAET1E Human Recombinant produced in E.Coli is a...
RAD51D Human
Product Name : RAD51D HumanDescription : RAD51D Human Recombinant produced in E. coli is....
RAD51D (1-328) Human
Product Name : RAD51D (1-328) HumanDescription : RAD51D (1-328) Human Recombinant produced in E....
RAD51B Human
Product Name : RAD51B HumanDescription : RAD51B Human Recombinant produced in E. coli is....
RAD1 Human
Product Name : RAD1 HumanDescription : RAD1 Recombinant Human produced in E.Coli is a...
Bcl 2 Human (minus BH3 domain)
Product Name : Bcl 2 Human (minus BH3 domain)Description : Bcl-2 Des BH3 domain...
RAC3 Human
Product Name : RAC3 HumanDescription : RAC3 Human Recombinant produced in E.Coli is a...
RAC2 Human, 189a.a
Product Name : RAC2 Human, 189a.aDescription : RAC2 Human Recombinant fused with 20 amino...
RAC2 Human
Product Name : RAC2 HumanDescription : Recombinant RAC2 produced in E.Coli is a single,...
RAC1 Human, His
Product Name : RAC1 Human, HisDescription : Ras-Related C3 Botulinum Toxin substrate 1 Human...
RAC1 Human
Product Name : RAC1 HumanDescription : RAC1 Human Recombinant produced in E.Coli is a...
RABL5 Human
Product Name : RABL5 HumanDescription : RABL5 Human Recombinant produced in E.coli is a...
RABIF Human
Product Name : RABIF HumanDescription : RABIF Human Recombinant produced in E.Coli is a...
RAB8 Human
Product Name : RAB8 HumanDescription : RAB8 Human Recombinant produced in E. coli is...
RAB7A Human
Product Name : RAB7A HumanDescription : RAB7A produced in E.Coli is a single, non-glycosylated...
RAB6B Human
Product Name : RAB6B HumanDescription : RAB6B Human Recombinant fused with a 20 amino acid...
Bcl 2 Human (minus BH2 domain)
Product Name : Bcl 2 Human (minus BH2 domain)Description : Bcl-2 Des BH2 domain...
RAB6A Human
Product Name : RAB6A HumanDescription : RAB6A Human Recombinant produced in E.coli is a...
RAB5C Human
Product Name : RAB5C HumanDescription : RAB5C Human Recombinant produced in E. coli is...
RAB5B Human
Product Name : RAB5B HumanDescription : RAB5B Human Recombinant fused with a 23 amino...
RAB5A Human
Product Name : RAB5A HumanDescription : RAB5A Human Recombinant produced in E.Coli is a...
RAB4A Human
Product Name : RAB4A HumanDescription : RAB4A produced in E.Coli is a single, non-glycosylated...
RAB3IL1 Human
Product Name : RAB3IL1 HumanDescription : RAB3IL1 Human Recombinant produced in E.Coli is a...
RAB3D Human
Product Name : RAB3D HumanDescription : RAB3D produced in E.Coli is a single, non-glycosylated...
RAB3B Human
Product Name : RAB3B HumanDescription : RAB3B Human Recombinant produced in E.coli is a...
RAB3A Human
Product Name : RAB3A HumanDescription : RAB3A produced in E.Coli is a single, non-glycosylated...
RAB39B Human
Product Name : RAB39B HumanDescription : RAB39B Human Recombinant produced in E.Coli is a...
Bcl 2 Human (minus BH1 domain)
Product Name : Bcl 2 Human (minus BH1 domain)Description : Bcl-2 Des BH1 domain...
RAB35 Human
Product Name : RAB35 HumanDescription : RAB35 Human Recombinant produced in E.Coli is a...
RAB34 Human
Product Name : RAB34 HumanDescription : RAB34 Human Recombinant produced in E.coli is a...
RAB32 Human
Product Name : RAB32 HumanDescription : RAB32 Human Recombinant produced in E.coli is a...
RAB31 Human
Product Name : RAB31 HumanDescription : RAB31 Human Recombinant produced in E.Coli is a...
RAB2B Human
Product Name : RAB2B HumanDescription : RAB2B Human Recombinant produced in E.Coli is a...
RAB2A Human
Product Name : RAB2A HumanDescription : RAB2A produced in E.Coli is a single, non-glycosylated...
RAB27B Human
Product Name : RAB27B HumanDescription : RAB27B Human Recombinant fused with a 20 amino...
RAB27A Human
Product Name : RAB27A HumanDescription : RAB27A Human Recombinant produced in E.Coli is a...
RAB24 Human
Product Name : RAB24 HumanDescription : RAB24 Human Recombinant produced in E.coli is a...
RAB23 Human
Product Name : RAB23 HumanDescription : RAB23 Human Recombinant produced in E.coli is a...
Bcl 2 Human (1-206 a.a.)
Product Name : Bcl 2 Human (1-206 a.a.)Description : Bcl-2 Human Recombinant produced in...
RAB22A Human
Product Name : RAB22A HumanDescription : RAB22A Human Recombinant produced in E.Coli is a...
RAB21 Human
Product Name : RAB21 HumanDescription : RAB21 Human Recombinant fused with a 37 amino acid...
RAB1B Human
Product Name : RAB1B HumanDescription : RAB1B Human Recombinant fused with a 20 amino...
RAB1A Human
Product Name : RAB1A HumanDescription : RAB1A produced in E.Coli is a single, non-glycosylated...
RAB18 Human
Product Name : RAB18 HumanDescription : RAB18 Human Recombinant produced in E.coli is a...
RAB17 Human
Product Name : RAB17 HumanDescription : RAB17 Human Recombinant produced in E.coli is a...
RAB14 Human
Product Name : RAB14 HumanDescription : RAB14 Human Recombinant produced in E.coli is a...
RAB13 Human
Product Name : RAB13 HumanDescription : RAB13 Human Recombinant produced in E.coli is a...
RAB11A Human
Product Name : RAB11A HumanDescription : RAB11A Human Recombinant produced in E.Coli is a...
RAB10 Human
Product Name : RAB10 HumanDescription : RAB10 Human Recombinant produced in E.coli is a...
BCL2 Human
Product Name : BCL2 HumanDescription : Recombinant Human BCL2 produced in E.coli cells is...
RSPO1 Human
Product Name : RSPO1 HumanDescription : R-Spondin-1 Human Recombinant produced in CHO cells is...
QKI Human
Product Name : QKI HumanDescription : QKI Human Recombinant produced in E.Coli is a...
PVR Human
Product Name : PVR HumanDescription : PVR Human Recombinant produced in Sf9 Insect cells...
PVALB Human
Product Name : PVALB HumanDescription : PVALB Human Recombinant fused with a 24 amino...
PURB Human
Product Name : PURB HumanDescription : PURB Human Recombinant produced in E.coli is a...
PTX3 Human, HEK
Product Name : PTX3 Human, HEKDescription : Pentraxin-3 Human Recombinant produced in HEK cells...
PTX3 Human
Product Name : PTX3 HumanDescription : Recombinant Human PTX3 produced in E.Coli is a...
PTX2 Mouse
Product Name : PTX2 MouseDescription : PTX2 Mouse Recombinant produced in Sf9 Insect cells is...
PTTG1 Human
Product Name : PTTG1 HumanDescription : PTTG1 Human Recombinant fused with a 20 amino...
PTMS Human
Product Name : PTMS HumanDescription : PTMS Human Recombinant produced in E.Coli is a...
BCL10 Human
Product Name : BCL10 HumanDescription : BCL10 Human Recombinant produced in E. coli is...
PTMA Human
Product Name : PTMA HumanDescription : PTMA Human Recombinant produced in E.coli is a...
PTEN Human, His
Product Name : PTEN Human, HisDescription : PTEN Human Recombinant fused with a 20...
PSTPIP1 Human
Product Name : PSTPIP1 HumanDescription : PSTPIP1 Human Recombinant produced in E.coli is a...
MSMB Human
Product Name : MSMB HumanDescription : MSMB Recombinant Human produced in E.Coli is a...
PSIP1 Human
Product Name : PSIP1 HumanDescription : Recombinant Human PSIP1 produced in SF9 is a...
PSG5 Human, Sf9
Product Name : PSG5 Human, Sf9Description : PSG5 Human Recombinant produced in Sf9 Insect...
PSG5 Human
Product Name : PSG5 HumanDescription : PSG5 Human Recombinant produced in E.coli is a...
PSG1 Human, Sf9
Product Name : PSG1 Human, Sf9Description : PSG1 Human Recombinant produced in Sf9 Baculovirus...
PSG1 Human
Product Name : PSG1 HumanDescription : PSG1 Human Recombinant produced in E.coli is a...
PSAP Human
Product Name : PSAP HumanDescription : PSAP Human Recombinant produced in HEK cells is...
BCDIN3D Human
Product Name : BCDIN3D HumanDescription : BCDIN3D Human Recombinant produced in E.Coli is a...
PRRX1 Human
Product Name : PRRX1 HumanDescription : PRRX1 Human Recombinant produced in E.Coli is a...
PRRT2 Human
Product Name : PRRT2 HumanDescription : PRRT2 Human Recombinant produced in E.coli is a...
PRPSAP2 Human
Product Name : PRPSAP2 HumanDescription : PRPSAP2 Human Recombinant produced in E. coli is...
Protein-L Cys
Product Name : Protein-L CysDescription : Recombinant Protein-L produced in E.Coli is a single...
Protein G
Product Name : Protein GDescription : The Protein G is a single, non-glycosylated protein...
Protein Cys-A/G
Product Name : Protein Cys-A/GDescription : Protein-A/G Recombinant produced in E.Coli is a single...
Protein A, 434 a.a
Product Name : Protein A, 434 a.aDescription : Recombinant Staphylococcal Protein A produced in...
Protein-A/G, His
Product Name : Protein-A/G, HisDescription : Protein-A/G Recombinant produced in E.Coli is a single...
Protein-A/G Cys
Product Name : Protein-A/G CysDescription : Protein-A/G Recombinant produced in E.Coli is a single...
Protein-A/G/L-Cys
Product Name : Protein-A/G/L-CysDescription : Recombinant Protein-A/G/L produced in E.Coli is a single non-glycosylated...
BCCIP Human
Product Name : BCCIP HumanDescription : BCCIP Human Recombinant produced in E.Coli is a...
Protein-A/G/L
Product Name : Protein-A/G/LDescription : Recombinant Protein-A/G/L produced in E.Coli is a single non-glycosylated...
Protein A/G
Product Name : Protein A/GDescription : The recombinant Protein A/G consists of 5 IgG-binding...
Protein A
Product Name : Protein ADescription : Recombinant Staphylococcal Protein A produced in E.Coli is...
Protein-L, His
Product Name : Protein-L, HisDescription : Recombinant Protein-L produced in E.Coli is a single...
Protein-L Cys, His
Product Name : Protein-L Cys, HisDescription : Recombinant Protein-L produced in E.Coli is a...
Protein-L
Product Name : Protein-LDescription : Protein-L Recombinant produced in E.coli is a single, non-glycosylated...
Protein-G His
Product Name : Protein-G HisDescription : Protein G His Tag Recombinant produced in E.Coli...
ProSpec 7-Band Marker
Product Name : ProSpec 7-Band MarkerDescription : ProSpec 7-Protein marker containing 8.5, 13.5, 18,...
ProSpec 8-Band Marker
Product Name : ProSpec 8-Band MarkerDescription : ProSpec 8-Protein marker containing 15. 20, 25, 35,...
PROSC Human
Product Name : PROSC HumanDescription : PROSC Human Recombinant produced in E.coli is a...
BCAR1 Human
Product Name : BCAR1 HumanDescription : BCAR1 Human Recombinant produced in E. coli is....
AFAP1 Human
Product Name : AFAP1 HumanDescription : AFAP1 Human Recombinant produced in E. coli is...
PROCR Human, Sf9
Product Name : PROCR Human, Sf9Description : PROCR Human Recombinant produced in Sf9 Baculovirus...
PROCR Human
Product Name : PROCR HumanDescription : PROCR Human Recombinant produced in E.coli is a...
PRNP Human
Product Name : PRNP HumanDescription : PRNP Human Recombinant produced in E.Coli is a...
PRND Human
Product Name : PRND HumanDescription : PRND Human Recombinant produced in E.Coli is a...
PRH1 Human
Product Name : PRH1 HumanDescription : PRH1 Human Recombinant produced in E.coli is a...
Prelamin-A
Product Name : Prelamin-ADescription : Recombinant Prelamin-A is a 74kDa precursor of the nuclear...
Transthyretin Human
Product Name : Transthyretin HumanDescription : Transthyertin Human Recombinant produced in E.Coli is a...
Prealbumin Human
Product Name : Prealbumin HumanDescription : Human Transthyretin dimer protein produced in Human plasma...
PRAP1 Human
Product Name : PRAP1 HumanDescription : PRAP1 Human Recombinant produced in E.Coli is a...
PQBP1 Human
Product Name : PQBP1 HumanDescription : PQBP1 Human Recombinant produced in E. coli is a...
Bax Mouse, GST
Product Name : Bax Mouse, GSTDescription : Bax Mouse Recombinant amino acid 1-171 produced...
PPP1R3B Human
Product Name : PPP1R3B HumanDescription : PPP1R3B Human Recombinant produced in E.coli is a...
PPP1R11 Human
Product Name : PPP1R11 HumanDescription : PPP1R11 Human Recombinant produced in E. coli is...
POU6F1 Human
Product Name : POU6F1 HumanDescription : POU6F1 Human Recombinant produced in E.Coli is a...
POU5F1 Human, PolyR
Product Name : POU5F1 Human, PolyRDescription : POU5F1 Human Recombinant produced in E.Coli is...
POU5F1 Human
Product Name : POU5F1 HumanDescription : POU5F1 Human Recombinant produced in E. coli is...
POU2AF1 Human
Product Name : POU2AF1 HumanDescription : POU2AF1 Human Recombinant produced in E.coli is a...
POR Human
Product Name : POR HumanDescription : POR produced in Sf9 Baculovirus cells is a...
POR Human, Active
Product Name : POR Human, ActiveDescription : POR produced in Sf9 Baculovirus cells is...
POR (43-677) Human
Product Name : POR (43-677) HumanDescription : POR Human Recombinant produced in Sf9 Insect...
POP7 Human
Product Name : POP7 HumanDescription : POP7 Human Recombinant produced in E.Coli is a...
Bax Mouse
Product Name : Bax MouseDescription : Bax Mouse Recombinant amino acid 38-171 produced in...
POP4 Human
Product Name : POP4 HumanDescription : POP4 Human Recombinant produced in E.Coli is a...
POMZP3 Human
Product Name : POMZP3 HumanDescription : POMZP3 Human Recombinant produced in E.coli is a...
POMC Human
Product Name : POMC HumanDescription : POMC produced in E.Coli is a single, non-glycosylated...
POLR3H Human
Product Name : POLR3H HumanDescription : POLR3H Human Recombinant produced in E.Coli is a...
POLR2K Human
Product Name : POLR2K HumanDescription : POLR2K Human Recombinant produced in E.Coli is a...
POLR2J Human
Product Name : POLR2J HumanDescription : POLR2J Human Recombinant produced in E.Coli is a...
POLR2H Human
Product Name : POLR2H HumanDescription : POLR2H Human Recombinant produced in E.Coli is a...
POLR2C Human
Product Name : POLR2C HumanDescription : POLR2C Human Recombinant produced in E.Coli is a...
POLR1C Human
Product Name : POLR1C HumanDescription : POLR1C Human Recombinant produced in E.Coli is a...
POLE3 Human
Product Name : POLE3 HumanDescription : POLE3 Human Recombinant produced in E. coli is...
Batroxobin
Product Name : BatroxobinDescription : Batroxobin, isolated from Bothrops atrox snake venom, has an...
POLD4 Human
Product Name : POLD4 HumanDescription : POLD4 Human Recombinant produced in E.coli is a...
Polcalcin Phl p 7
Product Name : Polcalcin Phl p 7Description : Recombinant Polcalcin Phl p 7 produced...
PODXL Mouse
Product Name : PODXL MouseDescription : PODXL Mouse Recombinant produced in Sf9 Baculovirus cells...
PODXL Human
Product Name : PODXL HumanDescription : PODXL Human Recombinant produced in HEK293 cells is...
PNRC2 Human
Product Name : PNRC2 HumanDescription : PNRC2 Human Recombinant produced in E. coli is...
PNOC Human
Product Name : PNOC HumanDescription : PNOC Human Recombinant produced in E.coli is a...
PMP2 Human, His
Product Name : PMP2 Human, HisDescription : PMP2 Human Recombinant produced in E.Coli is...
PMP2 Human
Product Name : PMP2 HumanDescription : PMP2 Human Recombinant produced in E.Coli is a...
PMF1-BGLAP Human
Product Name : PMF1-BGLAP HumanDescription : PMF1-BGLAP Human Recombinant produced in E.Coli is a...
PLSCR3 Human
Product Name : PLSCR3 HumanDescription : PLSCR3 Human Recombinant produced in E.Coli is a...
BATF Human
Product Name : BATF HumanDescription : BATF Human Recombinant fused with a 20 amino acid...
PLSCR1 Human
Product Name : PLSCR1 HumanDescription : PLSCR1 Human Recombinant produced in E.Coli is a...
PLEKHF2 Human
Product Name : PLEKHF2 HumanDescription : PLEKHF2 Human Recombinant produced in E.Coli is a...
PLDN Human
Product Name : PLDN HumanDescription : PLDN Human Recombinant produced in E. coli is...
PLCXD3 Human
Product Name : PLCXD3 HumanDescription : PLCXD3 Human Recombinant produced in E.Coli is a...
PLAUR Human
Product Name : PLAUR HumanDescription : PLAUR produced in Sf9 Baculovirus cells is a...
PLAC8 Human
Product Name : PLAC8 HumanDescription : PLAC8 Human Recombinant produced in E.Coli is a...
PKNOX1 Human
Product Name : PKNOX1 HumanDescription : PKNOX1 Human Recombinant produced in E.Coli is a...
PITPNB Human
Product Name : PITPNB HumanDescription : PITPNB Human Recombinant fused with a 20 amino...
PITPNA Human
Product Name : PITPNA HumanDescription : PITPNA Human Recombinant fused with a 20 amino...
PIR Human
Product Name : PIR HumanDescription : PIR Human Recombinant produced in E.Coli is a...
BATF3 Human
Product Name : BATF3 HumanDescription : BATF3 Human Recombinant produced in E.Coli is a...
PINX1 Human
Product Name : PINX1 HumanDescription : Recombinant Human PINX1 produced in E.Coli is a...
PIM2 Human
Product Name : PIM2 HumanDescription : PIM2 Human Recombinant produced in E.Coli is a...
PIM1 Human
Product Name : PIM1 HumanDescription : PIM1 Human Recombinant produced in E.Coli is a...
PIH1D2 Human
Product Name : PIH1D2 HumanDescription : PIH1D2 Human Recombinant produced in E.Coli is a...
PIH1D1 Human
Product Name : PIH1D1 HumanDescription : PIH1D1 Human Recombinant produced in E.Coli is a...
PIGR Human
Product Name : PIGR HumanDescription : PIGR Human produced in Sf9 Baculovirus cells is...
PI3 Human
Product Name : PI3 HumanDescription : PI3 Human Recombinant produced in E.coli is a...
Phospholipase A2
Product Name : Phospholipase A2Description : The E.Coli derived recombinant protein contains phospholipase P00630...
PHLDA2 Human
Product Name : PHLDA2 HumanDescription : PHLDA2 Human Recombinant produced in E.Coli is a...
PhI p 6
Product Name : PhI p 6Description : Recombinant Pollen allergen Phl p 6 produced...
BASP1 Human
Product Name : BASP1 HumanDescription : BASP1 Human Recombinant produced in E.coli is a...
PhI p 5
Product Name : PhI p 5Description : Recombinant Group V allergen Phl p 5.0203...
PhI p 2
Product Name : PhI p 2Description : Recombinant Pollen allergen Phl p 2 produced...
PhI p 12
Product Name : PhI p 12Description : Recombinant PhI p 12 produced in SF9...
PhI p 1
Product Name : PhI p 1Description : Recombinant Pollen allergen Phl p 1 produced...
PHF5A Human
Product Name : PHF5A HumanDescription : PHF5A Human Recombinant produced in E. coli is...
PHF13 Human
Product Name : PHF13 HumanDescription : PHF13 Human Recombinant produced in E. coli is...
PHF11 Human
Product Name : PHF11 HumanDescription : PHF11 Human Recombinant produced in E.Coli is a...
PHB Human
Product Name : PHB HumanDescription : PHB Human Recombinant produced in E.Coli is a...
PHB2 Human
Product Name : PHB2 HumanDescription : PHB2 Human Recombinant produced in E. coli is...
PGLYRP1 Human
Product Name : PGLYRP1 HumanDescription : PGLYRP1 Human Recombinant produced in E.Coli is a...
Bartonella SucB
Product Name : Bartonella SucBDescription : Recombinant Bartonella Henselae SucB produced in E.Coli is...
PGLYRP1 Human, HEK
Product Name : PGLYRP1 Human, HEKDescription : PGLYRP1 Human Recombinant produced in HEK293 Cells...
PFN4 Human
Product Name : PFN4 HumanDescription : PFN4 Human Recombinant produced in E.Coli is a...
PFN2 Human
Product Name : PFN2 HumanDescription : PFN2 Human Recombinant produced in E.Coli is a...
PFN1 Rat
Product Name : PFN1 RatDescription : PFN1 Rat Recombinant produced in E.Coli is a...
PFN1 Human
Product Name : PFN1 HumanDescription : PFN1 Human Recombinant produced in E.Coli is a...
PFDN6 Human
Product Name : PFDN6 HumanDescription : PFDN6 produced in E.Coli is a single, non-glycosylated...
PFDN5 Human
Product Name : PFDN5 HumanDescription : PFDN5 Human Recombinant produced in E.Coli is a...
PFDN4 Human
Product Name : PFDN4 HumanDescription : PFDN4 produced in E.Coli is a single, non-glycosylated...
PFDN2 Human
Product Name : PFDN2 HumanDescription : PFDN2 Human Recombinant fused with a 20 amino...
PFDN1 Human
Product Name : PFDN1 HumanDescription : PFDN1 Human Recombinant fused with a 20 amino...
Bartonella 26kDa
Product Name : Bartonella 26kDaDescription : Recombinant Bartonella Henselae 26kDa produced in E.Coli is...
PEX26 Human
Product Name : PEX26 HumanDescription : PEX26 Human Recombinant produced in E. coli is...
PEX19 Human
Product Name : PEX19 HumanDescription : PEX19 Human Recombinant produced in E.coli is a...
PET117 Human
Product Name : PET117 HumanDescription : PET117 Human Recombinant produced in E.coli is a...
Pen a 1.0101
Product Name : Pen a 1.0101Description : Recombinant Tropomyosin Pen a 1.0101 produced in...
PELI2 Human
Product Name : PELI2 HumanDescription : PELI2 Human Recombinant produced in E.Coli is a...
PEF1 Human
Product Name : PEF1 HumanDescription : PEF1 Human Recombinant fused with a 36 amino acid...
PEBP1 Mouse
Product Name : PEBP1 MouseDescription : PEBP1 Mouse Recombinant produced in E.Coli is a...
PEBP1 Human
Product Name : PEBP1 HumanDescription : PEBP1 Human Recombinant produced in E.Coli is a...
PEA15 Human
Product Name : PEA15 HumanDescription : PEA15 Human Recombinant produced in E.Coli is a...
PDZK1 Human
Product Name : PDZK1 HumanDescription : PDZK1 Human Recombinant produced in E.Coli is a...
Bartonella 17kDa
Product Name : Bartonella 17kDaDescription : Recombinant Bartonella Henselae 17kDa produced in E.Coli is...
PDZD11 Human
Product Name : PDZD11 HumanDescription : PDZD11 Human Recombinant produced in E.Coli is a...
PDRG1 Human
Product Name : PDRG1 HumanDescription : PDRG1 Human Recombinant fused with a 20 amino...
PDPN Human
Product Name : PDPN HumanDescription : PDPN Human Recombinant produced in E.Coli is a...
PDLIM1 Human
Product Name : PDLIM1 HumanDescription : PDLIM1 Human Recombinant produced in E.coli is a...
PDCL Human
Product Name : PDCL HumanDescription : PDCL Human Recombinant produced in E. coli is...
PDCL3 Human
Product Name : PDCL3 HumanDescription : PDCL3 Human Recombinant produced in E.coli is a...
PDCD6IP Human
Product Name : PDCD6IP HumanDescription : PDCD6IP Human Recombinant produced in E.Coli is a...
PDCD6 Human
Product Name : PDCD6 HumanDescription : PDCD6 produced in E.Coli is a single, non-glycosylated...
PDCD5 Human
Product Name : PDCD5 HumanDescription : PDCD5 Recombinant produced in E.Coli is a single,...
PDCD4 Human
Product Name : PDCD4 HumanDescription : PDCD4 Human Recombinant produced in E.Coli is a...
BAIAP2 Human
Product Name : BAIAP2 HumanDescription : BAIAP2 Human Recombinant produced in E.coli is a...
AES Human
Product Name : AES HumanDescription : AES Human Recombinant fused with a 20 amino acid...
PDCD1LG2 Human, Sf9
Product Name : PDCD1LG2 Human, Sf9Description : PDCD1LG2 Human Recombinant produced in Sf9 Baculovirus...
PDCD1LG2 Human
Product Name : PDCD1LG2 HumanDescription : PDCD1LG2 Human Recombinant produced in E.Coli is a...
PDCD1 Human
Product Name : PDCD1 HumanDescription : PDCD1 Human Recombinant produced in Sf9 Baculovirus cells...
PDCD1 Human, Active
Product Name : PDCD1 Human, ActiveDescription : PDCD1 Human Recombinant produced in HEK293 Cells...
PDAP1 Human
Product Name : PDAP1 HumanDescription : PDAP1 Recombinant Human produced in E.Coli is a...
PCSK9 Human
Product Name : PCSK9 HumanDescription : PCSK9 Human Recombinant produced in HEK cells is...
PCSK1N Human
Product Name : PCSK1N HumanDescription : PCSK1N Human Recombinant produced in E.coli is a...
PCP4L1 Human
Product Name : PCP4L1 HumanDescription : PCP4L1 Human Recombinant produced in E.Coli is a...
PCNP Human
Product Name : PCNP HumanDescription : PCNP Human Recombinant produced in E.Coli is a...
PCNA Human, Sf9
Product Name : PCNA Human, Sf9Description : PCNA Human Recombinant produced in SF9 is...
BAG3 Human
Product Name : BAG3 HumanDescription : BAG3 Human Recombinant produced in E.Coli is a...
PCNA Human
Product Name : PCNA HumanDescription : PCNA Human Recombinant produced in E.Coli is a...
PCMTD1 Human
Product Name : PCMTD1 HumanDescription : PCMTD1 Human Recombinant produced in E. coli is....
PCID2 Human
Product Name : PCID2 HumanDescription : PCID2 Human Recombinant produced in E.Coli is a...
PCDHGC4 Human
Product Name : PCDHGC4 HumanDescription : PCDHGC4 Human Recombinant produced in E.coli is a...
PCBP1 Human
Product Name : PCBP1 HumanDescription : PCBP1 Human Recombinant produced in E.coli is a...
PBLD Human
Product Name : PBLD HumanDescription : PBLD Human Recombinant fused with a 20 amino...
PAX9 Human
Product Name : PAX9 HumanDescription : PAX9 Human Recombinant produced in E.Coli is a...
PAX8 Human
Product Name : PAX8 HumanDescription : PAX8 Human Recombinant produced in E.Coli is a...
PARVA Human
Product Name : PARVA HumanDescription : PARVA Human Recombinant produced in E.Coli is a...
PARK7 Mouse
Product Name : PARK7 MouseDescription : PARK7 Mouse Recombinant produced in E.Coli is a...
BAG2 Human
Product Name : BAG2 HumanDescription : BAG2 Human Recombinant fused with a 20 amino acid...
PARK7 Human
Product Name : PARK7 HumanDescription : PARK7 Human Recombinant fused to an N-terminal 36...
PARK2 Human
Product Name : PARK2 HumanDescription : PARK2 Human Recombinant produced in E.coli is a...
PARD6B Human
Product Name : PARD6B HumanDescription : PARD6B Human Recombinant produced in E.coli is a...
PALM Human
Product Name : PALM HumanDescription : PALM Human Recombinant produced in E.coli is a...
PAIP2 Human
Product Name : PAIP2 HumanDescription : Recombinant Human PAIP2 produced in E.Coli is a...
PAEP Human
Product Name : PAEP HumanDescription : PAEP Human Recombinant produced in E.Coli is a...
PABPN1 Human
Product Name : PABPN1 HumanDescription : PABPN1 Human Recombinant produced in E.coli is a...
PA2G4 Human
Product Name : PA2G4 HumanDescription : PA2G4 produced in E.Coli is a single, non-glycosylated...
p59-Fyn Human
Product Name : p59-Fyn HumanDescription : p59-Fyn Human Recombinant (a.a. 23-216) expressed in E.coli,...
p53 Human
Product Name : p53 HumanDescription : p53 Human Recombinant full length produced in E.Coli...
BAG1 Human
Product Name : BAG1 HumanDescription : BAG1 Human Recombinant produced in E.Coli is a...
P Selectin Human
Product Name : P Selectin HumanDescription : P-Selectin Human Recombinant is expressed in E....
OXSR1 Human
Product Name : OXSR1 HumanDescription : OXSR1 Human Recombinant produced in E. coli is...
OXLD1 Human
Product Name : OXLD1 HumanDescription : OXLD1 Human Recombinant produced in E.Coli is a...
OVCA2 Human
Product Name : OVCA2 HumanDescription : OVCA2 Human Recombinant produced in E. coli is a...
OmpA
Product Name : OmpADescription : The recombinant form was found to be undistinguishable from...
OTUB2 Human
Product Name : OTUB2 HumanDescription : OTUB2 produced in E.Coli is a single, non-glycosylated...
OTUB1 Human
Product Name : OTUB1 HumanDescription : OTUB1 Human Recombinant fused with a 20 amino...
Ostreolysin
Product Name : OstreolysinDescription : Pleurotus Ostreatus Ostreolysin Recombinant produced in E.Coli is a...
SPARC Human, His
Product Name : SPARC Human, HisDescription : Osteonectin Human Recombinant fused with 6X His...
OSR2 Human
Product Name : OSR2 HumanDescription : OSR2 Human Recombinant produced in E.Coli is a...
BAD Protein Human
Product Name : BAD Protein HumanDescription : Bcl2 antagonist of cell death (BAD) Human...
OSCAR Human, Sf9
Product Name : OSCAR Human, Sf9Description : OSCAR produced in Sf9 Baculovirus cells is...
OSCAR Human
Product Name : OSCAR HumanDescription : OSCAR Human Recombinant produced in E.Coli is a...
ORM2 Human, sf9
Product Name : ORM2 Human, sf9Description : ORM2 Human Recombinant produced in Sf9 Baculovirus...
ORM2 Human
Product Name : ORM2 HumanDescription : ORM2 Human Recombinant produced in E.coli is a...
ORM1
Product Name : ORM1Description : ORM1 Human Recombinant produced in E.coli is a single,...
ORM1 Human, HEK
Product Name : ORM1 Human, HEKDescription : ORM1 Human Recombinant produced in HEK is...
ORC6 Human
Product Name : ORC6 HumanDescription : ORC6 Human Recombinant produced in E.coli is a...
ORAOV1 Human
Product Name : ORAOV1 HumanDescription : ORAOV1 Human Recombinant produced in E.Coli is a...
OPTC Human
Product Name : OPTC HumanDescription : OPTC Human Recombinant produced in E.Coli is a...
OMP Human
Product Name : OMP HumanDescription : OMP Human Recombinant produced in E.Coli is a...
B.Microti p41
Product Name : B.Microti p41Description : Recombinant Babesia Microti p41 produced in SF9 is...
OMG Human
Product Name : OMG HumanDescription : OMG Human Recombinant produced in Sf9 Baculovirus cells...
OLR1 Human, Sf9
Product Name : OLR1 Human, Sf9Description : OLR1 Human Recombinant produced in Sf9 Baculovirus...
OLR1 Human, HEK
Product Name : OLR1 Human, HEKDescription : OLR1 Human Recombinant produced in HEK cells...
OLR1 Human
Product Name : OLR1 HumanDescription : OLR1 Human Recombinant produced in E.coli is a...
OLFM1 Human
Product Name : OLFM1 HumanDescription : OLFM1 Human Recombinant produced in E.Coli is a...
OCM Human
Product Name : OCM HumanDescription : The Recombinant Human Oncomodulin-1 produced in E.coli has...
OCIAD2 Human
Product Name : OCIAD2 HumanDescription : OCIAD2 Human Recombinant produced in E.Coli is a...
OBFC1 Human
Product Name : OBFC1 HumanDescription : OBFC1 Human Recombinant produced in E. coli is....
OAZ1 Human
Product Name : OAZ1 HumanDescription : OAZ1 Human Recombinant produced in E. coli is...
NXT2 Human
Product Name : NXT2 HumanDescription : NXT2 Human Recombinant produced in E.Coli is a...
BABAM1 Human
Product Name : BABAM1 HumanDescription : BABAM1 Human Recombinant produced in E.Coli is a...
NXT1 Human
Product Name : NXT1 HumanDescription : NXT1 Human Recombinant fused with a 20 amino...
NXPH1 Human, Sf9
Product Name : NXPH1 Human, Sf9Description : NXPH1 Human Recombinant produced in Sf9 Baculovirus...
NXPH1 Human
Product Name : NXPH1 HumanDescription : NXPH1 Human Recombinant produced in E. coli is....
NUTF2 Human
Product Name : NUTF2 HumanDescription : NUTF2 Recombinant E.coli produced in E.Coli is a...
NusA E.Coli
Product Name : NusA E.ColiDescription : NusA Recombinant produced in E.Coli is a single,...
NUP62CL Human
Product Name : NUP62CL HumanDescription : NUP62CL Human Recombinant produced in E.Coli is a...
NUP62 Human
Product Name : NUP62 HumanDescription : NUP62 Human Recombinant produced in SF9 is a...
NUP210 Human
Product Name : NUP210 HumanDescription : Recombinant NUP210 protein is a construct carrying multiple...
NUDCD2 Human
Product Name : NUDCD2 HumanDescription : NUDCD2 Human Recombinant produced in E.Coli is a...
NUDC Human
Product Name : NUDC HumanDescription : NUDC Human Recombinant produced in E.Coli is a...
BAALC Human
Product Name : BAALC HumanDescription : BAALC Human Recombinant produced in E.Coli is a...
Nucleosome Bovine
Product Name : Nucleosome BovineDescription : Nucleosome Bovine shows multiple bands between 14-18kDa and...
NUCB2 Mouse
Product Name : NUCB2 MouseDescription : NUCB2 Mouse Recombinant fused to N-terminal His-Tag produced...
NUCB2 Human, His
Product Name : NUCB2 Human, HisDescription : The Recombinant Human NUCB2 (Nesfatin)Â produced in E.coli...
NUCB2 Human
Product Name : NUCB2 HumanDescription : The Recombinant Human NUCB2 (Nesfatin) produced in E.coli...
NUBP2 Human
Product Name : NUBP2 HumanDescription : NUBP2 Human Recombinant produced in E.Coli is a...
NUBP1 Human
Product Name : NUBP1 HumanDescription : NUBP1 Human Recombinant produced in E.Coli is a...
NTS Human, sf9
Product Name : NTS Human, sf9Description : NTS Human Recombinant produced in Sf9 Baculovirus...
NTS Human
Product Name : NTS HumanDescription : NTS Human Recombinant produced in E.Coli is a...
NTAL Human
Product Name : NTAL HumanDescription : NTAL Human Recombinant produced in E.Coli is a...
NSMCE1 Human
Product Name : NSMCE1 HumanDescription : NSMCE1 Human Recombinant produced in E.coli is a...
B9D2 Human
Product Name : B9D2 HumanDescription : B9D2 Human Recombinant produced in E.coli is a...
NSL1 Human
Product Name : NSL1 HumanDescription : NSL1 Human Recombinant produced in E.coli is a...
NSDHL Human
Product Name : NSDHL HumanDescription : NSDHL Human Recombinant produced in E. coli is...
NRIP3 Human
Product Name : NRIP3 HumanDescription : NRIP3 Human Recombinant produced in E.Coli is a...
NREP Human
Product Name : NREP HumanDescription : NREP Human Recombinant produced in E.coli is a...
NRBF2 Human
Product Name : NRBF2 HumanDescription : NRBF2 Human Recombinant produced in E.coli is a...
NRAS Human
Product Name : NRAS HumanDescription : NRAS Human Recombinant produced in E.Coli is a...
NPM2 Human
Product Name : NPM2 HumanDescription : NPM2 Human Recombinant produced in E. coli is...
NPM1 Human
Product Name : NPM1 HumanDescription : NPM1 Human Recombinant produced in E.Coli is a...
NPHS2 Human
Product Name : NPHS2 HumanDescription : NPHS2 Human Recombinant produced in E.Coli is a...
NOP16 Human
Product Name : NOP16 HumanDescription : NOP16 Human Recombinant produced in E.Coli is a...
B9D1 Human
Product Name : B9D1 HumanDescription : B9D1 Human Recombinant produced in E.Coli is a...
NOL3 Human
Product Name : NOL3 HumanDescription : NOL3 Human Recombinant produced in E. coli is...
NOB1 Human
Product Name : NOB1 HumanDescription : NOB1 Human Recombinant produced in E.coli is a...
NMRAL1 Human
Product Name : NMRAL1 HumanDescription : NMRAL1 Human Recombinant produced in E. coli is...
NMM Human
Product Name : NMM HumanDescription : Non-Muscle Myosin-II Regulatory Light Chain Human Recombinant full...
NMI Human
Product Name : NMI HumanDescription : NMI produced in E.Coli is a single, non-glycosylated...
NME4 Human
Product Name : NME4 HumanDescription : NME4 Human Recombinant fused with a 21 amino...
NME4 Human, Active
Product Name : NME4 Human, ActiveDescription : NME4 Human Recombinant produced in E.Coli is...
NME3 Human
Product Name : NME3 HumanDescription : NME3 Human Recombinant produced in E.Coli is a...
NME3 Human, Active
Product Name : NME3 Human, ActiveDescription : NME3 Human Recombinant produced in E.Coli is...
NME2 Human
Product Name : NME2 HumanDescription : NME2 Human Recombinant produced in E.Coli is a...
B2M Human Recombinant
Product Name : B2M Human RecombinantDescription : B2 Microglobulin Human Recombinant produced in E.Coli...
ADRM1 Human
Product Name : ADRM1 HumanDescription : ADRM1 Human Recombinant produced in E.Coli is a...
NME2 Human, Active
Product Name : NME2 Human, ActiveDescription : NME2 Human Recombinant produced in E.Coli is...
NME1 Human
Product Name : NME1 HumanDescription : NME1 Human Recombinant produced in E.Coli is a...
NME1 Human, Active
Product Name : NME1 Human, ActiveDescription : NME1 Human Recombinant produced in E.Coli is...
NMB Human
Product Name : NMB HumanDescription : NMB Human Recombinant produced in E.coli is a...
NKX3-1 Human
Product Name : NKX3-1 HumanDescription : NKX3-1 Human Recombinant produced in E.Coli is a...
NKp46 Mouse
Product Name : NKp46 MouseDescription : NKp46 Mouse Recombinant produced in Sf9 Baculovirus cells...
NKp46 Human
Product Name : NKp46 HumanDescription : NKp46 Human Recombinant produced in E.Coli is a...
NKIRAS2 Human
Product Name : NKIRAS2 HumanDescription : NKIRAS2 Human Recombinant produced in E.Coli is a...
NKIRAS1 Human
Product Name : NKIRAS1 HumanDescription : NKIRAS1 Human Recombinant produced in E.Coli is a...
RAET1E Human, IgG-His
Product Name : RAET1E Human, IgG-HisDescription : RAET1E Human Recombinant produced in Sf9 Insect...
B2M Human, His
Product Name : B2M Human, HisDescription : B2M Recombinant Human produced in E.Coli is...
KLRK1 Human, Sf9
Product Name : KLRK1 Human, Sf9Description : KLRK1 Human Recombinant produced in Sf9 Baculovirus...
NIPSNAP1 Human
Product Name : NIPSNAP1 HumanDescription : NIPSNAP1 Human Recombinant produced in E.Coli is a...
NIP7 Human
Product Name : NIP7 HumanDescription : NIP7 produced in E.Coli is a single, non-glycosylated...
NHP2L1 Human
Product Name : NHP2L1 HumanDescription : NHP2L1 produced in E.Coli is a single, non-glycosylated...
NHP2 Human
Product Name : NHP2 HumanDescription : NHP2 Human Recombinant fused with a 20 amino...
NHLH2 Human
Product Name : NHLH2 HumanDescription : NHLH2 Human Recombinant produced in E.Coli is a...
NHLH1 Human
Product Name : NHLH1 HumanDescription : NHLH1 Human Recombinant produced in E.coli is a...
NHEJ1 Human
Product Name : NHEJ1 HumanDescription : NHEJ1 Human Recombinant produced in E. coli is...
NFU1 Human
Product Name : NFU1 HumanDescription : NFU1 Human Recombinant produced in E.Coli is a...
NFKBID Human
Product Name : NFKBID HumanDescription : NFKBID Human Recombinant produced in E.coli is a...
B2M Human
Product Name : B2M HumanDescription : Human Beta-2 Microglobulin produced in Human urine from...
NFKBIB Human
Product Name : NFKBIB HumanDescription : NFKBIB Human Recombinant produced in E.Coli is a...
NFKBIA Human
Product Name : NFKBIA HumanDescription : NFKBIA Human Recombinant produced in E.coli is a...
NFE2L2 Human
Product Name : NFE2L2 HumanDescription : NFE2L2 Human Recombinant produced in E.Coli is a...
NFATC2 Human
Product Name : NFATC2 HumanDescription : NFATC2 produced in Sf9 Baculovirus cells is a...
NEURL2 Human
Product Name : NEURL2 HumanDescription : NEURL2 Human Recombinant produced in E.coli is a...
NELFE Human
Product Name : NELFE HumanDescription : NELFE Human Recombinant produced in E.coli is a...
NEFL Human
Product Name : NEFL HumanDescription : NEFL Human Recombinant produced in E.Coli is a...
NECTIN3 Human
Product Name : NECTIN3 HumanDescription : NECTIN3 produced in Sf9 Insect cells is a...
NECTIN2 Human
Product Name : NECTIN2 HumanDescription : NECTIN2 Human Recombinant produced in Sf9 Insect cells...
NECTIN1 Human
Product Name : NECTIN1 HumanDescription : NECTIN1 Human Recombinant produced in Sf9 Baculovirus cells...
AZGP1
Product Name : AZGP1Description : AZGP1 Human Recombinant produced in E.Coli is a single,...
NECAP2 Human
Product Name : NECAP2 HumanDescription : NECAP2 produced in E.Coli is a single, non-glycosylated...
NDRG3 Human
Product Name : NDRG3 HumanDescription : NDRG3 Human Recombinant produced in E. coli is...
NDRG2 Human
Product Name : NDRG2 HumanDescription : NDRG2 Human Recombinant produced in E. coli is...
NDRG1 Human
Product Name : NDRG1 HumanDescription : NDRG1 Human Recombinant fused with 8 amino acid...
NDE1 Human
Product Name : NDE1 HumanDescription : NDE1 produced in E.Coli is a single, non-glycosylated...
NDP Human
Product Name : NDP HumanDescription : NDP Human Recombinant produced in E.coli is a...
NDFIP1 Human
Product Name : NDFIP1 HumanDescription : NDFIP1 Human Recombinant produced in E. coli is....
NDEL1 Human
Product Name : NDEL1 HumanDescription : NDEL1 Human Recombinant produced in E.Coli is a...
NCS1 Human
Product Name : NCS1 HumanDescription : NCS1 Human Recombinant produced in E.Coli is a...
NCS1 213 a.a. Human
Product Name : NCS1 213 a.a. HumanDescription : NCS1 213 a.a. Human Recombinant produced...
AZGP1 Human, HEK
Product Name : AZGP1 Human, HEKDescription : ZA2G Human Recombinant produced in HEK cells...
NCR3LG1 Human
Product Name : NCR3LG1 HumanDescription : NCR3LG1 Human Recombinant produced in HEK is a...
NCR3 Human
Product Name : NCR3 HumanDescription : NCR3 Human Recombinant produced in E.Coli is a...
NCR2 Human
Product Name : NCR2 HumanDescription : NCR2 Human Recombinant produced in E.coli is a...
NCL Human
Product Name : NCL HumanDescription : Nucleolin Human Recombinant produced in SF9 is a...
NCK2 Human
Product Name : NCK2 HumanDescription : NCK2 Human Recombinant produced in E.coli is a...
NCK1 Human
Product Name : NCK1 HumanDescription : NCK1 Recombinant Human produced in E.Coli is a...
NCF4 Human
Product Name : NCF4 HumanDescription : NCF4 Human Recombinant produced in E.Coli is a...
NCF1 Human
Product Name : NCF1 HumanDescription : NCF1 Recombinant Human produced in E.Coli is a...
NCEH1 Human
Product Name : NCEH1 HumanDescription : NCEH1 Human Recombinant produced in E.Coli is a...
NCBP2 Human
Product Name : NCBP2 HumanDescription : NCBP2 produced in E.Coli is a single, non-glycosylated...
ATXN3 Human
Product Name : ATXN3 HumanDescription : ATXN3 produced in E.Coli is a single, non-glycosylated...
NCAM1 Human
Product Name : NCAM1 HumanDescription : NCAM1 Human Recombinant produced in Sf9 Baculovirus cells...
NCALD Human
Product Name : NCALD HumanDescription : NCALD produced in E.Coli is a single, non-glycosylated...
NBL1 Human
Product Name : NBL1 HumanDescription : NBL1 Human Recombinant produced in E.Coli is a...
NAPG Human
Product Name : NAPG HumanDescription : NAPG Human Recombinant produced in E.Coli is a...
NAPA Human
Product Name : NAPA HumanDescription : NAPA Human Recombinant produced in E.Coli is a...
NAP1L4 Human
Product Name : NAP1L4 HumanDescription : NAP1L4 Human Recombinant produced in E.coli is a...
NAP1L1 Human
Product Name : NAP1L1 HumanDescription : NAP1L1 Human Recombinant produced in E.Coli is a...
NANOGP8 Human
Product Name : NANOGP8 HumanDescription : NANOGP8 Human Recombinant produced in E.coli is a...
NANOG-TAT Human
Product Name : NANOG-TAT HumanDescription : NANOG Human Recombinant produced in E.Coli is a...
NANOG Human, His
Product Name : NANOG Human, HisDescription : NANOG Human Recombinant produced in E.coli is...
ATPIF1 Human
Product Name : ATPIF1 HumanDescription : ATPIF1 Human Recombinant produced in E.Coli is a...
NANOG Human
Product Name : NANOG HumanDescription : NANOG Human Recombinant produced in E.coli is a...
NAIF1 Human
Product Name : NAIF1 HumanDescription : NAIF1 Human Recombinant produced in E.Coli is a...
NACA Human
Product Name : NACA HumanDescription : NACA Human Recombinant produced in E.coli is a...
NABP1 Human
Product Name : NABP1 HumanDescription : NABP1 Human Recombinant produced in E.Coli is a...
MZB1 Human
Product Name : MZB1 HumanDescription : MZB1 Human Recombinant produced in E.coli is a...
MYOZ1 Human
Product Name : MYOZ1 HumanDescription : MYOZ1 Human Recombinant produced in E.Coli is a...
Myoglobin Human
Product Name : Myoglobin HumanDescription : Myoglobin Human Recombinant produced in E.Coli is a...
Myo Human w/o H
Product Name : Myo Human w/o HDescription : Myoglobin heme free Human Recombinant produced...
Myoglobin
Product Name : MyoglobinDescription : Human Myoglobin produced in Human Cardiac Tissues having a...
Myoglobin His Human
Product Name : Myoglobin His HumanDescription : MB produced in E.Coli is a single,...
ATP6V1F Human
Product Name : ATP6V1F HumanDescription : ATP6V1F Human Recombinant produced in E.Coli is a...
MYLPF Human
Product Name : MYLPF HumanDescription : MYLPF produced in E.Coli is a single, non-glycosylated...
MYL9 Mouse
Product Name : MYL9 MouseDescription : MYL9 Mouse Recombinant produced in E.Coli is a...
MYL9 Human
Product Name : MYL9 HumanDescription : MYL9 Human Recombinant fused with a20 amino acid...
MYL7 Human
Product Name : MYL7 HumanDescription : MYL7 Human Recombinant produced in E. coli is...
MYL6B Human
Product Name : MYL6B HumanDescription : MYL6B Human Recombinant produced in E.coli is a...
MYL6 Human
Product Name : MYL6 HumanDescription : MYL6 Human Recombinant fused with a 20 amino acid...
MYL5 Human
Product Name : MYL5 HumanDescription : MYL5 Human Recombinant produced in E.Coli is a...
MYL5 (1-173 a.a.) Human
Product Name : MYL5 (1-173 a.a.) HumanDescription : MYL5 Human Recombinant produced in E.Coli...
MYL4 Human
Product Name : MYL4 HumanDescription : MYL4 Human Recombinant produced in E.Coli is a...
MYL2 Human
Product Name : MYL2 HumanDescription : MYL2 Human Recombinant produced in E.Coli is a...
ATP6AP2 Human
Product Name : ATP6AP2 HumanDescription : ATP6AP2 Human Recombinant produced in E.Coli is a...
MYL1 Human
Product Name : MYL1 HumanDescription : Recombinant Human Ventricular Myosin Light Chain-1 (MYL1) protein...
MYL12B Human
Product Name : MYL12B HumanDescription : MYL12B Human Recombinant produced in E. coli is a...
MYL12A Human
Product Name : MYL12A HumanDescription : MYL12A Human Recombinant produced in E.Coli is a...
MYD88 Human
Product Name : MYD88 HumanDescription : MYD88 Human Recombinant produced in E.Coli is a...
MYCBP Human
Product Name : MYCBP HumanDescription : MYCBP Human Recombinant produced in E.Coli is a...
MYBPC3 Human
Product Name : MYBPC3 HumanDescription : MYBPC3 Human Recombinant produced in E.Coli is a...
MXD3 Human
Product Name : MXD3 HumanDescription : MXD3 Human Recombinant produced in E.coli is a...
MX2 Human
Product Name : MX2 HumanDescription : MX2 Human Recombinant produced in E.coli is a...
MX1 Human
Product Name : MX1 HumanDescription : MX1 Human Recombinant produced in E.Coli is a...
MX1 Bovine
Product Name : MX1 BovineDescription : MX1 Bovine Recombinant fused with a 20 amino...
ATP5H Human
Product Name : ATP5H HumanDescription : ATP5H Human Recombinant produced in E.coli is a...
MutS
Product Name : MutSDescription : DNA Mismatch Repair Protein MutS Thermus Aquaticus Recombinant produced...
BLOC1S5 Human
Product Name : BLOC1S5 HumanDescription : BLOC1S5 Human Recombinant produced in E.Coli is a...
MUSTN1 Human
Product Name : MUSTN1 HumanDescription : MUSTN1 Human Recombinant produced in E.Coli is a...
Osteocrin Human
Product Name : Osteocrin HumanDescription : The recombinant Human Osteocrin is produced with N-terminal...
MUP1 Mouse
Product Name : MUP1 MouseDescription : MUP1 Mouse Recombinant produced in E. coli is...
MUCL1 Human
Product Name : MUCL1 HumanDescription : MUCL1 Human Recombinant produced in E.Coli is a...
MTHSFD Human
Product Name : MTHSFD HumanDescription : MTHSFD Human Recombinant produced in E.Coli is a...
MTDH Human
Product Name : MTDH HumanDescription : Metadherin Human Recombinant produced in E.Coli is a...
MTCP1 Human
Product Name : MTCP1 HumanDescription : MTCP1 Human Recombinant produced in E.Coli is a...
MT3 Human
Product Name : MT3 HumanDescription : MT3 Human Recombinant produced in E. coli is...
ATP5F1 Human
Product Name : ATP5F1 HumanDescription : ATP5F1 Human Recombinant produced in E.coli is a...
Adipsin Human, Sf9
Product Name : Adipsin Human, Sf9Description : Adipsin produced in Sf9 Baculovirus cells is...
MSR1 Human, sf9
Product Name : MSR1 Human, sf9Description : MSR1 produced in Sf9 Baculovirus cells is...
MSI2 Human
Product Name : MSI2 HumanDescription : MSI2 Human Recombinant produced in E. coli is...
MSH6 Human
Product Name : MSH6 HumanDescription : MSH6 Human Recombinant produced in E.Coli is single,...
MRTO4 Human
Product Name : MRTO4 HumanDescription : MRTO4 Human Recombinant produced in E. coli is...
MRRF Human
Product Name : MRRF HumanDescription : MRRF Human Recombinant produced in E.Coli is a...
MRPS2 Human
Product Name : MRPS2 HumanDescription : MRPS2 Human Recombinant produced in E.coli is a...
MRPS28 Human
Product Name : MRPS28 HumanDescription : MRPS28 Human Recombinant produced in E.Coli is a...
MRPS25 Human
Product Name : MRPS25 HumanDescription : MRPS25 Human Recombinant produced in E.coli is a...
MRPS23 Human
Product Name : MRPS23 HumanDescription : MRPS23 Human Recombinant produced in E.Coli is a...
MRPL48 Human
Product Name : MRPL48 HumanDescription : MRPL48 Human Recombinant produced in E.Coli is a...
ATP5C1 Human
Product Name : ATP5C1 HumanDescription : ATP5C1 Human Recombinant produced in E.Coli is a...
MRPL2 Human
Product Name : MRPL2 HumanDescription : MRPL2 Human Recombinant produced in E.Coli is a...
MRPL28 Human
Product Name : MRPL28 HumanDescription : MRPL28 Human Recombinant produced in E. coli is...
MRPL1 Human
Product Name : MRPL1 HumanDescription : MRPL1 Human Recombinant produced in E. coli is...
MRPL13 Human
Product Name : MRPL13 HumanDescription : MRPL13 Human Recombinant produced in E.Coli is a...
MRM1 Human
Product Name : MRM1 HumanDescription : MRM1 Human Recombinant produced in E. coli is...
MRFAP1L1 Human
Product Name : MRFAP1L1 HumanDescription : MRFAP1L1 Human Recombinant produced in E.Coli is a...
MREG Human
Product Name : MREG HumanDescription : MREG Human Recombinant produced in E.Coli is a...
MRAS Human
Product Name : MRAS HumanDescription : MRAS Human Recombinant produced in E.Coli is a...
MPZL1 Human
Product Name : MPZL1 HumanDescription : MPZL1 Human Recombinant produced in E.coli is a...
MPPED2 Human
Product Name : MPPED2 HumanDescription : MPPED2 Human Recombinant produced in E.Coli is a...
ATP1B3 Human
Product Name : ATP1B3 HumanDescription : ATP1B3 Human Recombinant produced in E.coli is a...
S100b Mouse
Product Name : S100b MouseDescription : s100b Mouse Recombinant produced in E.Coli is a...
MOSPD1 Human
Product Name : MOSPD1 HumanDescription : MOSPD1 Human Recombinant produced in E.Coli is a...
MORF4L2 Human
Product Name : MORF4L2 HumanDescription : MORF4L2 produced in E.Coli is a single, non-glycosylated...
MORF4L1 Human
Product Name : MORF4L1 HumanDescription : MORF4L1 Human Recombinant produced in E.Coli is a...
MORC3 Human
Product Name : MORC3 HumanDescription : Recombinant Human MORC Family CW-Type Zinc Finger 3...
MOG Human
Product Name : MOG HumanDescription : Myelin Oligodendrocyte Glycoprotein produced in E.Coli is a...
MOG
Product Name : MOGDescription : Myelin Oligodendrocyte Glycoprotein is a single, non-glycosylated polypeptide chain...
MoeX
Product Name : MoeXDescription : Recombinant Mycobacterium Tuberculosis MoeX produced in E.Coli is a...
MOCS2 Human
Product Name : MOCS2 HumanDescription : MOCS2 Human Recombinant produced in E. coli is...
MOBKL3 Human
Product Name : MOBKL3 HumanDescription : MOBKL3 Human Recombinant fused with a 20 amino...
ATP1B2 Human, Sf9
Product Name : ATP1B2 Human, Sf9Description : ATP1B2 Human Recombinant produced in Sf9 Baculoviruscells...
MOBKL1B Human
Product Name : MOBKL1B HumanDescription : MOBKL1B Human Recombinant fused with a 20 amino...
MOAP1 Human
Product Name : MOAP1 HumanDescription : MOAP1 Human Recombinant produced in E.Coli is a...
MNDA Human
Product Name : MNDA HumanDescription : MNDA Human Recombinant produced in E.Coli is a...
MMADHC Human
Product Name : MMADHC HumanDescription : MMADHC Human Recombinant produced in E.coli is a...
MMACHC Human
Product Name : MMACHC HumanDescription : MMACHC Human Recombinant produced in E.Coli is a...
MLLT11 Human
Product Name : MLLT11 HumanDescription : MLLT11 Human Recombinant produced in E.Coli is a...
MLF1 Human
Product Name : MLF1 HumanDescription : MLF1 Human Recombinant fused with a 20 amino acid...
MLEC Human
Product Name : MLEC HumanDescription : MLEC Human Recombinant produced in E.coli is a...
MLANA Human
Product Name : MLANA HumanDescription : MLANA Human Recombinant produced in E. coli is...
MIS12 Human
Product Name : MIS12 HumanDescription : MIS12 Human Recombinant produced in E.Coli is a...
ATP1B2 Human
Product Name : ATP1B2 HumanDescription : ATP1B2 Human Recombinant produced in E.coli is a...
MINA Human
Product Name : MINA HumanDescription : MINA Human Recombinant produced in E.Coli is a...
MIEN1 Human
Product Name : MIEN1 HumanDescription : MIEN1 Human Recombinant produced in E.Coli is a...
MICA Human, His
Product Name : MICA Human, HisDescription : MICA Human Recombinant produced in E.Coli is...
MICB Human
Product Name : MICB HumanDescription : MICB Human Recombinant produced in E.Coli is a...
MICA Human
Product Name : MICA HumanDescription : MICA Human Recombinant produced in E.Coli is a...
MGP Human
Product Name : MGP HumanDescription : MGP Human Recombinant produced in E.coli is a...
MFAP4 Human, Sf9
Product Name : MFAP4 Human, Sf9Description : MFAP4 Human Recombinant produced in Sf9 Baculovirus...
MFAP4 Human
Product Name : MFAP4 HumanDescription : MFAP4 Human Recombinant produced in E. coli is...
MFAP3 Human
Product Name : MFAP3 HumanDescription : MFAP3 Human Recombinant produced in E.coli is a...
MFAP2 Human
Product Name : MFAP2 HumanDescription : MFAP2 Human Recombinant produced in E.Coli is a...
ATP1B1 Human, Sf9
Product Name : ATP1B1 Human, Sf9Description : ATP1B1 Human Recombinant produced in Sf9 Baculovirus...
METRNL Human
Product Name : METRNL HumanDescription : METRNL Human Recombinant produced in E.Coli is a...
METRN Mouse
Product Name : METRN MouseDescription : METRN produced in Sf9 Baculovirus cells is a...
MET Human
Product Name : MET HumanDescription : Met Proto-Oncogene Human Recombinant produced in Insect cells...
MESDC2 Mouse
Product Name : MESDC2 MouseDescription : MESDC2 Mouse Recombinant produced in E.Coli is a...
MESDC2 Human
Product Name : MESDC2 HumanDescription : MESDC2 Human Recombinant fused with a 21 amino...
MESDC1 Human
Product Name : MESDC1 HumanDescription : MESDC1 Human Recombinant produced in E.coli is a...
MEP1B Mouse
Product Name : MEP1B MouseDescription : MEP1B produced in Sf9 Insect cells is a...
MEP1A Human
Product Name : MEP1A HumanDescription : MEP1A produced in Sf9 Baculovirus cells is a...
MEOX2 Human
Product Name : MEOX2 HumanDescription : MEOX2 Human Recombinant produced in E. coli is...
MEMO1 Human
Product Name : MEMO1 HumanDescription : MEMO1 Human Recombinant produced in E.Coli is a...
ATP1B1 Human
Product Name : ATP1B1 HumanDescription : ATP1B1 Human Recombinant produced in E.coli is a...
MEIS3 Human
Product Name : MEIS3 HumanDescription : MEIS3 Human Recombinant produced in E.Coli is a...
MED7 Human
Product Name : MED7 HumanDescription : MED7 Human Recombinant produced in E. coli is...
MED4 Human
Product Name : MED4 HumanDescription : MED4 produced in E.Coli is a single, non-glycosylated...
MED27 Human
Product Name : MED27 HumanDescription : MED27 Human Recombinant produced in E.coli is a...
MED21 Human
Product Name : MED21 HumanDescription : MED21 Human Recombinant produced in E.Coli is a...
MED20 Human
Product Name : MED20 HumanDescription : MED20 Human Recombinant produced in E.Coli is a...
MECP2 Human
Product Name : MECP2 HumanDescription : MECP2 Human Recombinant is expressed in 293 cells....
MECOM Human
Product Name : MECOM HumanDescription : MECOM Human Recombinant produced in E.Coli is a...
MCTS1 Human
Product Name : MCTS1 HumanDescription : MCTF1 Human Recombinant produced in E.Coli is a...
MCM7 Human
Product Name : MCM7 HumanDescription : MCM7 Human Recombinant produced in E.coli is a...
ATOX1 Human
Product Name : ATOX1 HumanDescription : ATOX1 Human Recombinant produced in E.Coli is a...
MCL1 Human
Product Name : MCL1 HumanDescription : MCL1 Human Recombinant produced in E. coli is...
MCFD2 Human
Product Name : MCFD2 HumanDescription : MCFD2 Human Recombinant produced in E.Coli is a...
MCAM Human
Product Name : MCAM HumanDescription : MCAM produced in Sf9 Insect cells is a...
MBP Human
Product Name : MBP HumanDescription : MBP Human Recombinant produced in E.coli is a...
MBP E.Coli, His
Product Name : MBP E.Coli, HisDescription : Recombinant E.Coli MBP produced in E.Coli is...
MBP (27-396) E.Coli
Product Name : MBP (27-396) E.ColiDescription : Recombinant E.Coli MBP produced in E.Coli is...
MBL2 Human, Sf9
Product Name : MBL2 Human, Sf9Description : MBL2 produced in Sf9 Baculovirus cells is...
MBL2 Human
Product Name : MBL2 HumanDescription : MBL2 Human Recombinant produced in E. coli is...
MBIP Human
Product Name : MBIP HumanDescription : MBIP Human Recombinant produced in E. coli is...
MBD3 Human
Product Name : MBD3 HumanDescription : MBD3 Human Recombinant produced in E. coli is...
ATOH1 Human
Product Name : ATOH1 HumanDescription : ATOH1 Human Recombinant produced in E. coli is...
MAX Human
Product Name : MAX HumanDescription : MAX Human Recombinant produced in E.Coli is a...
MAVS Human
Product Name : MAVS HumanDescription : MAVS Human Recombinant produced in E.coli is a...
SERPINB5 Human
Product Name : SERPINB5 HumanDescription : SERPINB5 Human Recombinant produced in E.Coli is a...
MARCKSL1 Human
Product Name : MARCKSL1 HumanDescription : MARCKSL1 Human Recombinant produced in E. coli is...
MAPT Human 412a.a.
Product Name : MAPT Human 412a.a.Description : MAPT Human Recombinant (Isoform 5) fused with...
MAPT Human 383a.a.
Product Name : MAPT Human 383a.a.Description : MAPT Human Recombinant (Isoform 3) fused with...
MAPT Human 381a.a.
Product Name : MAPT Human 381a.a.Description : MAPT Human Recombinant fused with a 20...
MAPT Human
Product Name : MAPT HumanDescription : MAPT Recombinant Human (Isoform-4) produced in E.Coli is...
MAPRE3 Human
Product Name : MAPRE3 HumanDescription : MAPRE3 produced in E.Coli is a single, non-glycosylated...
MAPRE2 Human
Product Name : MAPRE2 HumanDescription : MAPRE2 Human Recombinant produced in E.Coli is a...
ATG5 Human
Product Name : ATG5 HumanDescription : ATG5 produced in E.Coli is a single, non-glycosylated...
MAPRE1 Human
Product Name : MAPRE1 HumanDescription : MAPRE1 Human Recombinant fused with a 20 amino...
MAPKSP1 Human
Product Name : MAPKSP1 HumanDescription : MAPKSP1 produced in E.Coli is a single, non-glycosylated...
MAP1LC3B Mouse
Product Name : MAP1LC3B MouseDescription : MAP1LC3B Mouse Recombinant produced in E.Coli is a...
MAP1LC3B Human
Product Name : MAP1LC3B HumanDescription : MAP1LC3B produced in E.Coli is a single, non-glycosylated...
MAP1LC3B2 Human
Product Name : MAP1LC3B2 HumanDescription : MAP1LC3B2 produced in E.Coli is a single, non-glycosylated...
MAP1LC3A Human
Product Name : MAP1LC3A HumanDescription : MAP1LC3A Recombinant Human produced in E.Coli is a...
MAOC Leishmania
Product Name : MAOC LeishmaniaDescription : Recombinant Leishmania Donovani Maoc Family Dehydratase-Like Protein produced...
MBP (27-392) E.Coli
Product Name : MBP (27-392) E.ColiDescription : Maltose Binding Protein E.Coli Recombinant produced in...
MALD3
Product Name : MALD3Description : Recombinant Non-Specific Lipid-Transfer Protein Mal d 3 produced in...
MALD1
Product Name : MALD1Description : Recombinant MALD1 produced in SF9 is a glycosylated, polypeptide...
ATG4B Human
Product Name : ATG4B HumanDescription : ATG4B Human Recombinant produced in E.Coli is a...
Adipsin Human
Product Name : Adipsin HumanDescription : Adipsin Human Recombinant produced in E.Coli is a...
MAK16 Human
Product Name : MAK16 HumanDescription : MAK16 Human Recombinant produced in E.Coli is a...
MAGOHB Human
Product Name : MAGOHB HumanDescription : MAGOHB Human Recombinant produced in E.Coli is a...
MAGOH Human
Product Name : MAGOH HumanDescription : MAGOH Human Recombinant produced in E.Coli is a...
MAGED1 Human
Product Name : MAGED1 HumanDescription : MAGED1 Human Recombinant produced in E.Coli is a...
MAGEB10 Human
Product Name : MAGEB10 HumanDescription : MAGEB10 Human Recombinant produced in E.Coli is a...
MAGEA8 Human
Product Name : MAGEA8 HumanDescription : MAGEA8 Human Recombinant produced in E.Coli is a...
MAGEA6 Human
Product Name : MAGEA6 HumanDescription : MAGEA6 Human Recombinant produced in E.Coli is a...
MAGEA5 Human
Product Name : MAGEA5 HumanDescription : MAGEA5 Human Recombinant produced in E. coli is a...
MAGEA4 Human
Product Name : MAGEA4 HumanDescription : MAGEA4 Recombinant Human produced in E.Coli is a...
MAGEA3 Human
Product Name : MAGEA3 HumanDescription : MAGEA3 produced in E.Coli is a single, non-glycosylated...
ATG3 Human
Product Name : ATG3 HumanDescription : ATG3 Human Recombinant produced in E.Coli is a...
MAFK Human
Product Name : MAFK HumanDescription : MAFK Human Recombinant produced in E.Coli is a...
MAFG Human
Product Name : MAFG HumanDescription : MAFG Human Recombinant produced in E.coli is a...
MAFF Human
Product Name : MAFF HumanDescription : MAFF Human Recombinant produced in E. coli is...
MAF1 Human
Product Name : MAF1 HumanDescription : MAF1 Human Recombinant produced in E.coli is a...
MAEA Human
Product Name : MAEA HumanDescription : MAEA Human Recombinant (isoform 1) produced in E.coli...
MAD2L1BP Human
Product Name : MAD2L1BP HumanDescription : MAD2L1BP Human Recombinant produced in E.Coli is a...
MAD2L1 Human
Product Name : MAD2L1 HumanDescription : MAD2L1 Human Recombinant produced in E.Coli is a...
M6PR Human
Product Name : M6PR HumanDescription : M6PR Human Recombinant produced in E.coli is a...
LZTFL1 Human
Product Name : LZTFL1 HumanDescription : LZTFL1 Human Recombinant produced in E.Coli is a...
LZIC Human
Product Name : LZIC HumanDescription : LZIC Human Recombinant produced in E.coli is a...
ATG10 Human
Product Name : ATG10 HumanDescription : ATG10 Human Recombinant produced in E. coli is...
LYN Human
Product Name : LYN HumanDescription : LYN Human Recombinant produced in E.coli is a...
LYG2 Human
Product Name : LYG2 HumanDescription : LYG2 Human Recombinant produced in E. coli is...
LY9 Human
Product Name : LY9 HumanDescription : LY9 Human Recombinant produced in Sf9 Baculovirus cells...
LY86 Human
Product Name : LY86 HumanDescription : LY86 Human Recombinant produced in E.coli is a...
LY6G6F Human
Product Name : LY6G6F HumanDescription : LY6G6F Human Recombinant produced in E.coli is a...
LY6D Human
Product Name : LY6D HumanDescription : LY6D Human Recombinant produced in E.coli is a...
LXN Mouse
Product Name : LXN MouseDescription : LXN Mouse Recombinant produced in E.Coli is a...
LUM Mouse
Product Name : LUM MouseDescription : LUM Mouse Recombinant produced in Sf9 Baculovirus cells...
LUM Human, sf9
Product Name : LUM Human, sf9Description : LUM Human Recombinant produced in Sf9 Baculovirus...
LUM Human
Product Name : LUM HumanDescription : LUM Human Recombinant produced in E.Coli is a...
ASPSCR1 Human
Product Name : ASPSCR1 HumanDescription : ASPSCR1 Human Recombinant produced in E. coli is...
LTF Human S.Plasma
Product Name : LTF Human S.PlasmaDescription : The Human Lactoferrin produced from pooled Human...
LTF Human
Product Name : LTF HumanDescription : The Human Lactoferrin produced from Human breast milk...
LSM5 Human
Product Name : LSM5 HumanDescription : LSM5 Human Recombinant produced in E.Coli is a...
LSM4 Human
Product Name : LSM4 HumanDescription : LSM4 Human Recombinant fused with a 20 amino...
LSM3 Human
Product Name : LSM3 HumanDescription : LSM3 Human Recombinant produced in E. coli is...
LSM2 Human
Product Name : LSM2 HumanDescription : LSM2 Human Recombinant produced in E. coli is a...
LSM1 Human
Product Name : LSM1 HumanDescription : LSM1 Human Recombinant fused with a 20 amino...
LSM12 Human
Product Name : LSM12 HumanDescription : LSM12 Human Recombinant produced in E.Coli is a...
LRRC59 Human
Product Name : LRRC59 HumanDescription : LRRC59 Human Recombinant produced in E.coli is a...
LRPAP1 Mouse
Product Name : LRPAP1 MouseDescription : LRPAP1 Mouse Recombinant produced in E.Coli is a...
ASPHD1 Human
Product Name : ASPHD1 HumanDescription : ASPHD1 Human Recombinant produced in E.Coli is a...
LRPAP1 Human
Product Name : LRPAP1 HumanDescription : LRPAP1 Human Recombinant produced in E.coli is a...
LRP4 Human
Product Name : LRP4 HumanDescription : LRP4 Human Recombinant is a single, glycosylated polypeptide...
LRP2BP Human
Product Name : LRP2BP HumanDescription : LRP2BP Human Recombinant produced in E. coli is...
LRIG1 Mouse
Product Name : LRIG1 MouseDescription : LRIG1 Mouse produced in Sf9 Baculovirus cells is...
LRG1 Human, Sf9
Product Name : LRG1 Human, Sf9Description : LRG1 produced in Sf9 Baculovirus cells is...
LRG1 Protein
Product Name : LRG1 ProteinDescription : The Human LRG1 produced from human pooled serum...
LRG1 Canine
Product Name : LRG1 CanineDescription : The Canine LRG1 produced from pooled Canine Serum...
LMX1B Human
Product Name : LMX1B HumanDescription : LMX1B Human Recombinant produced in E.Coli is a...
LMO1 Human
Product Name : LMO1 HumanDescription : LMO1 Human Recombinant produced in E.Coli is a...
LMNA Rat
Product Name : LMNA RatDescription : LMNA Rat Recombinant fused with a His tag...
ASNA1 Human
Product Name : ASNA1 HumanDescription : ASNA1 Human Recombinant produced in E. coli is...
LMNA Human
Product Name : LMNA HumanDescription : LMNA Human Recombinant fused with a His tag...
LITAF Human
Product Name : LITAF HumanDescription : LITAF Human Recombinant produced in E.coli is a...
LLO PEST free
Product Name : LLO PEST freeDescription : Recombinant Listeriolysin O s a single polypeptide...
LLO
Product Name : LLODescription : LLO is a single, non-glycosylated polypeptide chain containing 529...
LINGO1 Human
Product Name : LINGO1 HumanDescription : LINGO1 Human Recombinant produced in E.Coli is a...
LIN7C Human
Product Name : LIN7C HumanDescription : LIN7C Human Recombinant produced in E.Coli is a...
LIN7B Human
Product Name : LIN7B HumanDescription : LIN7B Human Recombinant produced in E.Coli is a...
LIN7A Human
Product Name : LIN7A HumanDescription : LIN7A Human Recombinant produced in E.Coli is a...
LIN28B Human
Product Name : LIN28B HumanDescription : LIN28B Human Recombinant produced in E. coli is...
LIN28 Human
Product Name : LIN28 HumanDescription : Recombinant Human LIN28 produced in E.Coli is a...
ASGR2 Human
Product Name : ASGR2 HumanDescription : ASGR2 Human Recombinant produced in E.Coli is a...
LIMD2 Human
Product Name : LIMD2 HumanDescription : LIMD2 Human Recombinant produced in E.coli is a...
LILRB2 Human
Product Name : LILRB2 HumanDescription : LILRB2 Human Recombinant produced in HEK293 Cells is...
LILRB1 Human
Product Name : LILRB1 HumanDescription : LILRB1 Human Recombinant produced in Sf9 Baculovirus cells...
LGALSL Human
Product Name : LGALSL HumanDescription : LGALSL Human Recombinant produced in E.Coli is a...
LECT2 Human
Product Name : LECT2 HumanDescription : LECT2 Human Recombinant produced in E.Coli is a...
LECT1 Human
Product Name : LECT1 HumanDescription : LECT1 Human Recombinant produced in E. coli is....
LECT1 (214-333) Human
Product Name : LECT1 (214-333) HumanDescription : LECT1 Human Recombinant produced in E. coli...
LDOC1L Human
Product Name : LDOC1L HumanDescription : LDOC1L Human Recombinant produced in E.Coli is a...
LDLRAP1 Human
Product Name : LDLRAP1 HumanDescription : LDLRAP1 Human Recombinant produced in E.coli is a...
LDL Human
Product Name : LDL HumanDescription : Human Low Density Lipoprotein (LDL) produced in Human...
ASF1B Human
Product Name : ASF1B HumanDescription : ASF1B Human Recombinant produced in E.Coli is a...
LCP2 Human
Product Name : LCP2 HumanDescription : LCP2 produced in Sf9 Baculovirus cells is a...
LBP Human, HEK
Product Name : LBP Human, HEKDescription : LBP Human Recombinant is a single, glycosylated...
LBP Mouse
Product Name : LBP MouseDescription : LBP is produced from mouse LBP transfected CHO-cells...
LBP Human
Product Name : LBP HumanDescription : The Lipopolysaccharide Binding Protein is produced from human...
LBH Human
Product Name : LBH HumanDescription : LBH Human Recombinant produced in E.Coli is a...
LAYN Human
Product Name : LAYN HumanDescription : LAYN Human Recombinant produced in E.coli is a...
LAT Human
Product Name : LAT HumanDescription : LAT Human Recombinant produced in E.coli is a...
LASP1 Human
Product Name : LASP1 HumanDescription : LASP1 Human Recombinant produced in E.coli is a...
LANCL1 Human
Product Name : LANCL1 HumanDescription : LANCL1 Human Recombinant produced in E.Coli is a...
LAMTOR4 Human
Product Name : LAMTOR4 HumanDescription : LAMTOR4 Human Recombinant produced in E.Coli is a...
ASF1A Human
Product Name : ASF1A HumanDescription : ASF1A Human Recombinant produced in E.Coli is a...
LAMTOR2 Human
Product Name : LAMTOR2 HumanDescription : LAMTOR2 Human Recombinant produced in E.Coli is a...
LAMP3 Human
Product Name : LAMP3 HumanDescription : LAMP3 produced in Sf9 Baculovirus cells is a...
LAMP2 Mouse
Product Name : LAMP2 MouseDescription : LAMP2 Mouse Recombinant produced in Sf9 Baculovirus cells...
LAMP2 Human
Product Name : LAMP2 HumanDescription : LAMP2 is a full-length cDNA coding for the...
LAMP1 Human
Product Name : LAMP1 HumanDescription : LAMP1 produced in Sf9 Baculovirus cells is a...
Lamin-A Human
Product Name : Lamin-A HumanDescription : Recombinant Human Lamin A produced in E.Coli is...
LAIR2 Human
Product Name : LAIR2 HumanDescription : LAIR2 Human Recombinant produced in E.Coli is a...
LAIR1 Mouse
Product Name : LAIR1 MouseDescription : LAIR1 Mouse Recombinant produced in Sf9 Baculovirus cells...
LAIR1 Human
Product Name : LAIR1 HumanDescription : LAIR1 Recombinant produced in E.Coli is a single,...
LAGE3 Human
Product Name : LAGE3 HumanDescription : LAGE3 Human Recombinant produced in E. coli is...
ASCC1 Human
Product Name : ASCC1 HumanDescription : ASCC1 Human Recombinant produced in E.coli is a...
LTF Holo Human
Product Name : LTF Holo HumanDescription : Recombinant Human Holo Lactoferrin produced in Plant...
LTF Apo Human
Product Name : LTF Apo HumanDescription : Recombinant Human Apo Lactoferrin produced in Plant is...
LA/SS-B Human
Product Name : LA/SS-B HumanDescription : LA/SS-B Human Recombinant produced in SF9 is a...
L1CAM Human
Product Name : L1CAM HumanDescription : L1CAM Human Recombinant produced in Sf9 Baculovirus cells...
L Selectin Human
Product Name : L Selectin HumanDescription : L-Selectin Human Recombinant is expressed in E....
L-Selectin Human, Sf9
Product Name : L-Selectin Human, Sf9Description : L-Selectin produced in Sf9 Baculovirus cells is...
KXD1 Human
Product Name : KXD1 HumanDescription : KXD1 Human Recombinant produced in E.Coli is a...
Ku P70/P80 Human
Product Name : Ku P70/P80 HumanDescription : KuP70/P80 Human Recombinant produced in SF9 insect...
KRT8 Human, His
Product Name : KRT8 Human, HisDescription : KRT8 Human Recombinant produced in E.Coli is...
KRT8 Human, GST
Product Name : KRT8 Human, GSTDescription : Cytokeratin 8 Human Recombinant full length protein...
ASB8 Human
Product Name : ASB8 HumanDescription : ASB8 Human Recombinant produced in E.coli is a...
ADFP Human
Product Name : ADFP HumanDescription : ADFP Human Recombinant produced in E.Coli is a...
KRT8 Human
Product Name : KRT8 HumanDescription : Cytokeratin 8 Human Recombinant produced in E.Coli is...
KRT5 Human
Product Name : KRT5 HumanDescription : KRT5 Human Recombinant produced in E.coli is a...
KRT20 Human, His
Product Name : KRT20 Human, HisDescription : KRT20 Human Recombinant produced in E.Coli is...
KRT20 Human
Product Name : KRT20 HumanDescription : Cytokeratin 20 Human Recombinant produced in E.Coli is...
KRT19 Human, His
Product Name : KRT19 Human, HisDescription : KRT19 Human Recombinant produced in E.coli is...
KRT19 Human
Product Name : KRT19 HumanDescription : Cytokeratin 19 Human Recombinant produced in E.Coli is...
KRT18 Human, His
Product Name : KRT18 Human, HisDescription : KRT18 Human Recombinant produced in E.Coli is...
KRT18 Human
Product Name : KRT18 HumanDescription : Cytokeratin 18 Human Recombinant produced in E.Coli is...
KRT17 Human
Product Name : KRT17 HumanDescription : KRT17 Human Recombinant produced in E.Coli is a...
KRT16 Human
Product Name : KRT16 HumanDescription : KRT16 Human Recombinant produced in E.coli is a...
ASB13 Human
Product Name : ASB13 HumanDescription : ASB13 Human Recombinant produced in E.Coli is a...
KRT14 Human, His
Product Name : KRT14 Human, HisDescription : KRT14 Human Recombinant produced in E.Coli is...
KRT14 Human
Product Name : KRT14 HumanDescription : Cytokeratin 14 Human Recombinant produced in E.Coli is...
KRAS 2B Human
Product Name : KRAS 2B HumanDescription : KRAS 2B Recombinant human produced in E.Coli...
KRAS 2A Human
Product Name : KRAS 2A HumanDescription : KRAS 2A Human Recombinant produced in E.Coli...
KPNB1 Human
Product Name : KPNB1 HumanDescription : KPNB1 Human Recombinant produced in E.Coli is a...
KPNA2 Human
Product Name : KPNA2 HumanDescription : KPNA2 Human Recombinant produced in E.coli is a...
KLRK1 Human
Product Name : KLRK1 HumanDescription : KLRK1 Human Recombinant produced in E.Coli is a...
KLRG1 Human
Product Name : KLRG1 HumanDescription : KLRG1 Human Recombinant produced in E.Coli is a...
KLRF1 Human
Product Name : KLRF1 HumanDescription : KLRF1 Human Recombinant produced in HEK293 Cells is...
KLRD1 Human
Product Name : KLRD1 HumanDescription : KLRD1 produced in Sf9 Baculovirus cells is a...
Art v 1
Product Name : Art v 1Description : Recombinant Art v 1 produced in SF9...
KLRC3 Human
Product Name : KLRC3 HumanDescription : KLRC3 Human Recombinant produced in E. coli is...
KLRC2 Human
Product Name : KLRC2 HumanDescription : KLRC2 Human Recombinant produced in E. coli is...
KLRC1 Human
Product Name : KLRC1 HumanDescription : KLRC1 Human Recombinant produced in Sf9 Baculovirus cells...
KLRB1 Human, Sf9
Product Name : KLRB1 Human, Sf9Description : KLRB1 produced in Sf9 Baculovirus cells is...
KLRB1 Human
Product Name : KLRB1 HumanDescription : KLRB1 Human Recombinant produced in E. coli is...
KLHDC8B Human
Product Name : KLHDC8B HumanDescription : KLHDC8B Human Recombinant produced in E.Coli is a...
KLF7 Human
Product Name : KLF7 HumanDescription : KLF7 Human Recombinant produced in E. coli is...
KLF6 Human
Product Name : KLF6 HumanDescription : KLF6 Human Recombinant produced in E. coli is....
KLF4 Human, His
Product Name : KLF4 Human, HisDescription : KLF4 Human Recombinant produced in E.Coli is...
KLF4 Human
Product Name : KLF4 HumanDescription : KLF4 Human Recombinant produced in E.coli is a...
ARPP19 Human
Product Name : ARPP19 HumanDescription : ARPP19 Human Recombinant produced in E.Coli is a...
KLF3 Human
Product Name : KLF3 HumanDescription : KLF3 Human Recombinant produced in E.coli is a...
KLF12 Human
Product Name : KLF12 HumanDescription : KLF12 Human Recombinant produced in E.Coli is a...
KISS1 Human
Product Name : KISS1 HumanDescription : KISS1 Human Recombinant produced in E.Coli is a...
KIR3DL2 Human
Product Name : KIR3DL2 HumanDescription : KIR3DL2 Human Recombinant produced in Sf9 Baculovirus cells...
KIR3DL1 Human
Product Name : KIR3DL1 HumanDescription : Recombinant KIR3DL1 produced in E.Coli is a single,...
KIR2DS4 Human
Product Name : KIR2DS4 HumanDescription : Recombinant Human KIR2DS4 produced in E.Coli is a...
KIR2DL5A Human
Product Name : KIR2DL5A HumanDescription : KIR2DL5A Human Recombinant produced in Sf9 Baculovirus cells...
KIR2DL4 Human
Product Name : KIR2DL4 HumanDescription : KIR2DL4 Human Recombinant produced in Sf9 Insect cells...
KIR2DL3 Human
Product Name : KIR2DL3 HumanDescription : Recombinant KIR2DL3 produced in E.Coli is a single,...
KIR2DL1 Human
Product Name : KIR2DL1 HumanDescription : KIR2DL1 Recombinant produced in E.Coli is a single,...
ARPC5 Human
Product Name : ARPC5 HumanDescription : ARPC5 Human Recombinant fused with a 20 amino...
KIN Human
Product Name : KIN HumanDescription : KIN Human Recombinant produced in E. coli is...
KIAA0513 Human
Product Name : KIAA0513 HumanDescription : KIAA0513 Human Recombinant produced in E.Coli is a...
KIAA0101 Human
Product Name : KIAA0101 HumanDescription : KIAA0101 Human Recombinant produced in E.coli is a...
KHDC1L Human
Product Name : KHDC1L HumanDescription : KHDC1L Human Recombinant produced in E.Coli is a...
KCTD5 Human
Product Name : KCTD5 HumanDescription : KCTD5 Human Recombinant produced in E. coli is...
KCTD4 Human
Product Name : KCTD4 HumanDescription : KCTD4 Human Recombinant produced in E.Coli is a...
KCTD15 Human
Product Name : KCTD15 HumanDescription : KCTD15 Human Recombinant produced in E.Coli is a...
KCTD11 Human
Product Name : KCTD11 HumanDescription : KCTD11 Human Recombinant produced in E.Coli is a...
KCNMB3 Human
Product Name : KCNMB3 HumanDescription : KCNMB3 Human Recombinant produced in E.Coli is a...
KCNIP3 Human
Product Name : KCNIP3 HumanDescription : KCNIP3 Human Recombinant fused with a 20 amino...
ARPC3 Human
Product Name : ARPC3 HumanDescription : ARPC3 Human Recombinant produced in E.Coli is a...
KAAG1 Human
Product Name : KAAG1 HumanDescription : KAAG1 Human Recombinant fused with a 20 amino...
JTB Human
Product Name : JTB HumanDescription : JTB Human Recombinant produced in E.Coli is a...
JSRP1 Human
Product Name : JSRP1 HumanDescription : JSRP1 Human Recombinant produced in E.coli is a...
JOSD1 Human
Product Name : JOSD1 HumanDescription : JOSD1 Human Recombinant produced in E.Coli is a...
JMJD7 Human
Product Name : JMJD7 HumanDescription : JMJD7 Human Recombinant produced in E.Coli is a...
JMJD6 Human
Product Name : JMJD6 HumanDescription : JMJD6 Human Recombinant produced in E.Coli is a...
JDP2 Human
Product Name : JDP2 HumanDescription : JDP2 Human Recombinant produced in E.Coli is a...
JAZF1 Human
Product Name : JAZF1 HumanDescription : JAZF1 Human Recombinant produced in E.Coli is a...
JAM3 Human
Product Name : JAM3 HumanDescription : JAM3 Human Recombinant produced in E. coli is...
JAM2 Human, Sf9
Product Name : JAM2 Human, Sf9Description : JAM2 produced in Sf9 Baculovirus cells is...
ARPC2 Human
Product Name : ARPC2 HumanDescription : ARPC2 Human Recombinant produced in E.Coli is a...
JAM2 Human
Product Name : JAM2 HumanDescription : JAM2 Human Recombinant produced in E.coli is a...
ITGB4 Human
Product Name : ITGB4 HumanDescription : ITGB4 produced in Sf9 Baculovirus cells is a...
ITGB3BP Human
Product Name : ITGB3BP HumanDescription : ITGB3BP Human Recombinant produced in E. coli is...
ITGB1BP3 Human
Product Name : ITGB1BP3 HumanDescription : ITGB1BP3 Human Recombinant produced in E. coli is...
ITGB1 Human, Sf9
Product Name : ITGB1 Human, Sf9Description : ITGB1 Human Recombinant produced in Sf9 Baculovirus...
ITGB1 Human
Product Name : ITGB1 HumanDescription : ITGB1 Human Recombinant produced in E. coli is...
ISOC2 Human
Product Name : ISOC2 HumanDescription : ISOC2 Human Recombinant produced in E.coli is a...
ISG15 Human
Product Name : ISG15 HumanDescription : ISG15 Human Recombinant fused to N-terminal Calmudulin Tag...
ISCU Human
Product Name : ISCU HumanDescription : ISCU Human Recombinant fused with a 21 amino...
IRGM Human
Product Name : IRGM HumanDescription : IRGM Human Recombinant produced in E.coli is a...
ARMS2 Human
Product Name : ARMS2 HumanDescription : ARMS2 Human Recombinant produced in E.Coli is a...
IPP-POZ Human
Product Name : IPP-POZ HumanDescription : IPP-POZ Human Recombinant produced in E.Coli is a...
IF Human
Product Name : IF HumanDescription : Intrinsic Factor Human Recombinant produced in baculovirus is...
Intein Bacillus Circulans
Product Name : Intein Bacillus CirculansDescription : Intein Bacillus Recombinant produced in E.coli is...
ING2 Human
Product Name : ING2 HumanDescription : ING2 Human Recombinant produced in E.Coli is a...
ING1 Human
Product Name : ING1 HumanDescription : ING1 Human Recombinant produced in E.Coli is a...
IMPAD1 Mouse Bioactive
Product Name : IMPAD1 Mouse BioactiveDescription : IMPAD1 Mouse Recombinant produced in Sf9 Baculoviruscells...
IMPAD1 Mouse
Product Name : IMPAD1 MouseDescription : IMPAD1 produced in Sf9 Insect cells is a...
IMPAD1 Human
Product Name : IMPAD1 HumanDescription : IMPAD1 Human Recombinant produced in E.Coli is a...
IMPAD1 Human, Active
Product Name : IMPAD1 Human, ActiveDescription : IMPAD1 Human Recombinant produced in E.Coli is...
IMPACT Human
Product Name : IMPACT HumanDescription : IMPACT Human Recombinant produced in E.Coli is a...
ARMC10 Human
Product Name : ARMC10 HumanDescription : ARMC10 Human Recombinant produced in E.Coli is a...
IMP3 Human
Product Name : IMP3 HumanDescription : IMP3 Human Recombinant produced in E.Coli is a...
IGSF8 Human
Product Name : IGSF8 HumanDescription : IGSF8 Human Recombinant produced in Sf9 Baculovirus cells...
IgM Human
Product Name : IgM HumanDescription : Human Immunoglobulin-M produced in human plasma having a...
IGLL1 Human
Product Name : IGLL1 HumanDescription : IGLL1 Human Recombinant produced in E.Coli is a...
IGJ Human
Product Name : IGJ HumanDescription : IGJ Human Recombinant produced in E. coli is...
IgG Mouse, His
Product Name : IgG Mouse, HisDescription : IgG Mouse Recombinant produced in Hi-5 cells...
IgG Mouse
Product Name : IgG MouseDescription : IgG Mouse Recombinant produced in Hi-5 cells is...
IgG1 Fc Human
Product Name : IgG1 Fc HumanDescription : IgG1 Fc Human Recombinant produced in HEK...
IGFLR1 Human
Product Name : IGFLR1 HumanDescription : IGFLR1 Human Recombinant produced in E. coli is...
IFT20 Human
Product Name : IFT20 HumanDescription : IFT20 Human Recombinant produced in E. coli is...
ARL9 Human
Product Name : ARL9 HumanDescription : ARL9 Human Recombinant produced in E.Coli is a...
IFIH1 Human
Product Name : IFIH1 HumanDescription : IFIH1 Human Recombinant produced in SF9 is a...
IER3 Human
Product Name : IER3 HumanDescription : IER3 Human Recombinant produced in E.Coli is a...
ID2 Human
Product Name : ID2 HumanDescription : ID2 Human Recombinant produced in E.Coli is a...
ID1 Human
Product Name : ID1 HumanDescription : ID1 Human Recombinant produced in E. coli is...
ICT1 Human
Product Name : ICT1 HumanDescription : ICT1 Human Recombinant produced in E.Coli is a...
ICOSLG Human
Product Name : ICOSLG HumanDescription : ICOSLG produced in Sf9 Baculovirus cells is a...
ICOS Human
Product Name : ICOS HumanDescription : ICOS produced in Sf9 Baculovirus cells is a...
ICAM5 Human
Product Name : ICAM5 HumanDescription : ICAM5 Human Recombinant produced in HEK293 is a...
ICAM3 Human
Product Name : ICAM3 HumanDescription : ICAM3 Human Recombinant produced in Sf9 Baculovirus cells...
ICAM2 Human
Product Name : ICAM2 HumanDescription : ICAM2 Human Recombinant produced in E.coli is a...
ARL6 Human
Product Name : ARL6 HumanDescription : ARL6 Human Recombinant produced in E.Coli is a...
ACTR3 Human
Product Name : ACTR3 HumanDescription : ACTR3 Human Recombinant produced in E.Coli is a...
ICAM1 Human, Sf9
Product Name : ICAM1 Human, Sf9Description : ICAM1 produced in Sf9 Baculovirus cells is...
ICAM1 Human HEK
Product Name : ICAM1 Human HEKDescription : ICAM1 Human Recombinant produced by mammalian expression...
ICAM1 Mouse
Product Name : ICAM1 MouseDescription : ICAM1 Mouse Recombinant produced in Sf9 Baculovirus cells...
ICAM-1 Human
Product Name : ICAM-1 HumanDescription : ICAM-1 Human Recombinant is expressed in E. coli...
IBSP Human, HEK
Product Name : IBSP Human, HEKDescription : IBSP Human Recombinant produced in HEK293 Cells...
HUS1 Human
Product Name : HUS1 HumanDescription : HUS1 produced in E.Coli is a single, non-glycosylated...
TARDBP (1-414) Human
Product Name : TARDBP (1-414) HumanDescription : TARDBP Human Recombinant produced in E.Coli is...
STIP1 Human
Product Name : STIP1 HumanDescription : STIP1 Human Recombinant produced in E.Coli is a...
S100b Human
Product Name : S100b HumanDescription : S100bHuman Recombinant produced in E.Coli is a single,...
ORM1 Human
Product Name : ORM1 HumanDescription : The Human Orosomucoid 1 produced from Human pooled...
ARL5B Human
Product Name : ARL5B HumanDescription : ARL5B Human Recombinant produced in E.Coli is a...
LRG1 Human
Product Name : LRG1 HumanDescription : LRG1 Human Recombinant produced in E.coli is a...
LIN28 Human, TAT
Product Name : LIN28 Human, TATDescription : Recombinant Human LIN28 produced in E.Coli is...
Hemopexin Human
Product Name : Hemopexin HumanDescription : Hemopexin Human Recombinant produced in E. coli is....
FABP4 Human
Product Name : FABP4 HumanDescription : The Human FABP4 produced from Human Adipose Tissue...
FABP2 Human
Product Name : FABP2 HumanDescription : FABP2 Human Recombinant produced in E.Coli is a...
FABP1 Human
Product Name : FABP1 HumanDescription : FABP1 Human Recombinant produced in E.Coli is a...
DKK1 Human
Product Name : DKK1 HumanDescription : DKK1 Human Recombinant produced in E.Coli is a...
BCL2L2 Human
Product Name : BCL2L2 HumanDescription : Recombinant Human BCL2L2 produced in E.coli cells is...
AZGP1 Human
Product Name : AZGP1 HumanDescription : The Human Zinc-Alpha 2 Glycoprotein produced from Human...
ANXA2 Human
Product Name : ANXA2 HumanDescription : The Human Annexin A2 produced from Human Adipose...
ARL5A Human
Product Name : ARL5A HumanDescription : ARL5A produced in E.Coli is a single, non-glycosylated...
AHSG
Product Name : AHSGDescription : The human Alpha-2-HS-Glycoprotein containing 349 a.a was purified from...
HSPH1 Human
Product Name : HSPH1 HumanDescription : Recombinant HSPH1 produced in E.Coli is a single,...
HSPBP1 Human
Product Name : HSPBP1 HumanDescription : HSPBP1 Human Recombinant produced in E.Coli is a...
HSPBAP1 Human
Product Name : HSPBAP1 HumanDescription : HSPBAP1 Human Recombinant fused with a 20 amino...
HSPB9 Human
Product Name : HSPB9 HumanDescription : HSPB9 Human Recombinant produced in E.Coli is a...
HSPB8 Human, His
Product Name : HSPB8 Human, HisDescription : HSPB8 Human Recombinant produced in E.Coli is...
HSPB8 Human
Product Name : HSPB8 HumanDescription : Recombinant Human Heat Shock Protein 22 kDa Protein-8...
HSPB7 Human
Product Name : HSPB7 HumanDescription : HSPB7 Human Recombinant produced in E.Coli is a...
HSPB6 Human
Product Name : HSPB6 HumanDescription : HSPB6 Human Recombinant produced in E.Coli is a...
HSPB3 Human
Product Name : HSPB3 HumanDescription : HSPB3 Human Recombinant produced in E.coli is a...
ARL4D Human
Product Name : ARL4D HumanDescription : ARL4D Human Recombinant produced in E.coli is a...
HSPB2 Human
Product Name : HSPB2 HumanDescription : HSPB2 Human Recombinant produced in E. coli is a...
HSPB11 Human
Product Name : HSPB11 HumanDescription : HSPB11 produced in E.Coli is a single, non-glycosylated...
HSP27 Mouse
Product Name : HSP27 MouseDescription : HSP27 Mouse Recombinant produced in E.Coli is a...
HSPA9 Human
Product Name : HSPA9 HumanDescription : Recombinant Human HSPA9 produced in E.Coli is a...
HSPA8 Human
Product Name : HSPA8 HumanDescription : Recombinant Human HSC70 produced in E.Coli is a...
HSPA6 Human
Product Name : HSPA6 HumanDescription : Recombinant Human HSPA6 produced in E.Coli is a...
HSPA5 Mouse
Product Name : HSPA5 MouseDescription : HSPA5 Mouse Recombinant produced in E.Coli is a...
HSPA5 Human, Hi-5
Product Name : HSPA5 Human, Hi-5Description : HSPA5 produced in Hi-5 cells is a...
HSPA5 Human
Product Name : HSPA5 HumanDescription : Recombinant Human HSPA5 produced in E.Coli is a...
HSPA5 (19-654) Human
Product Name : HSPA5 (19-654) HumanDescription : HSPA5 (19-654) Human Recombinant produced in E.coli...
ARL4A Human
Product Name : ARL4A HumanDescription : ARL4A Human Recombinant produced in E.coli is a...
HSPA1B Human
Product Name : HSPA1B HumanDescription : The HSPA1B Protein Human produced in E.Coli is...
HSPA13 Human
Product Name : HSPA13 HumanDescription : HSPA13 produced in E.Coli is a single, non-glycosylated...
HSP90B1 Human, HEK
Product Name : HSP90B1 Human, HEKDescription : HSP90B1 Human Recombinant produced in HEK cells...
HSP90B1 Human
Product Name : HSP90B1 HumanDescription : HSP90B1 produced in E.Coli is a single, non-glycosylated...
HSP90 Alpha Human
Product Name : HSP90 Alpha HumanDescription : Recombinant Human HSP-90 produced in E.Coli is...
HSP27 Human, His
Product Name : HSP27 Human, HisDescription : Recombinant Human HSP-27 produced in E.Coli is...
HSP27 Human
Product Name : HSP27 HumanDescription : Recombinant Human HSP-27 produced in E.Coli is a...
HSP20 Human
Product Name : HSP20 HumanDescription : Heat Shock Protein 20 Human Recombinant produced in...
HSP104 Saccharomyces
Product Name : HSP104 SaccharomycesDescription : Recombinant HSP104 produced in E.Coli is a single,...
HSFY1 Human
Product Name : HSFY1 HumanDescription : HSFY1 Human Recombinant produced in E. coli is...
ARL3 Human
Product Name : ARL3 HumanDescription : ARL3 Human Recombinant produced in E.Coli is a...
HSF2BP Human
Product Name : HSF2BP HumanDescription : HSF2BP Human Recombinant produced in E.Coli is a...
HSF1 Human
Product Name : HSF1 HumanDescription : Recombinant Human HSF1 produced in E.Coli is a...
HSCB Human
Product Name : HSCB HumanDescription : HSCB Human Recombinant produced in E. coli is...
HSBP1L1 Human
Product Name : HSBP1L1 HumanDescription : HSBP1L1 Human Recombinant produced in E.Coli is a...
HSBP 1 Human
Product Name : HSBP 1 HumanDescription : Recombinant Human HSBP1 produced in E.Coli is...
HSA, Sf9
Product Name : HSA, Sf9Description : HSA produced in Sf9 Baculovirus cells is a...
HSA Recombinant, HEK
Product Name : HSA Recombinant, HEKDescription : Recombinant Human Serum Albumin produced in HEK...
HSA Recombinant, Plant
Product Name : HSA Recombinant, PlantDescription : HSA Human Recombinant produced in Plant is...
HSA, Pichia Pastoris
Product Name : HSA, Pichia PastorisDescription : HSA Human Recombinant produced in Pichia Pastoris...
HSA Fatty Acid free
Product Name : HSA Fatty Acid freeDescription : HSA Human Recombinant Fatty Acid reduced...
ARL2BP Human
Product Name : ARL2BP HumanDescription : ARL2BP Human Recombinant produced in E.coli is a...
HRSP12 Human
Product Name : HRSP12 HumanDescription : HRSP12 Human Recombinant fused with a 20 amino...
HRAS Human
Product Name : HRAS HumanDescription : HRAS Human Recombinant produced in E.Coli is a...
HPR Human
Product Name : HPR HumanDescription : HPR Human Recombinant produced in E.Coli is a...
HPCAL1 Human
Product Name : HPCAL1 HumanDescription : HPCAL1 Human Recombinant produced in E.Coli is a...
HOXC11 Human
Product Name : HOXC11 HumanDescription : 800×600 HOXC11 Human Recombinant produced in E.Coli is...
HOXB13 Human
Product Name : HOXB13 HumanDescription : HOXB13 Human Recombinant produced in E.Coli is a...
HOXA9 Human
Product Name : HOXA9 HumanDescription : HOXA9 Human Recombinant produced in E.coli is a...
HOPX Human
Product Name : HOPX HumanDescription : HOPX Human Recombinant produced in E.Coli is a...
HOMER3 Human
Product Name : HOMER3 HumanDescription : HOMER3 Human Recombinant produced in E. coli is a...
HOMER2 Human
Product Name : HOMER2 HumanDescription : HOMER2 Human Recombinant produced in E. coli is...
ARL2 Human
Product Name : ARL2 HumanDescription : ARL2 Human Recombinant fused with a 20 amino...
HOMER1 Human
Product Name : HOMER1 HumanDescription : Recombinant Human HOMER1 produced in E.Coli is a...
HNRNPK Human
Product Name : HNRNPK HumanDescription : HNRNPK Human Recombinant produced in E. coli is...
HNRNPC Human
Product Name : HNRNPC HumanDescription : HNRNPC produced in E.Coli is a single, non-glycosylated...
HNRNPAB Human
Product Name : HNRNPAB HumanDescription : HNRNPAB Human Recombinant produced in E.Coli is a...
HNRNPA1 Human
Product Name : HNRNPA1 HumanDescription : HNRNPA1 Human Recombinant produced in E.Coli is a...
HN1L Human
Product Name : HN1L HumanDescription : HN1L Human Recombinant produced in E.Coli is a...
HN1 Human
Product Name : HN1 HumanDescription : HN1 Human Recombinant produced in E. coli is...
HMGN3 Human
Product Name : HMGN3 HumanDescription : HMGN3 Human Recombinant produced in E.Coli is a...
HMGN1 Human
Product Name : HMGN1 HumanDescription : HMGN1 Human Recombinant produced in E.Coli is a...
HMGB3 Human
Product Name : HMGB3 HumanDescription : HMGB3 Human Recombinant produced in E.coli is a...
ARL1 Human
Product Name : ARL1 HumanDescription : ARL1 Recombinant Human produced in E.Coli is a...
HMGB2 Human
Product Name : HMGB2 HumanDescription : HMGB2 Human Recombinant produced in Baculovirus is a...
HMGB1 Human, Sf9
Product Name : HMGB1 Human, Sf9Description : HMG1 Human Recombinant fused to an 8...
HMGB1 Human
Product Name : HMGB1 HumanDescription : HMG1 Human Recombinant fused with 6X His tag...
HMGA2 Human
Product Name : HMGA2 HumanDescription : HMGA2 Human Recombinant produced in E.Coli is a...
HMGA1 Human
Product Name : HMGA1 HumanDescription : HMGA1 Human Recombinant produced in E.Coli is a...
HLA-DRB1 Human, Sf9
Product Name : HLA-DRB1 Human, Sf9Description : HLA-DRB1 produced in Sf9 Baculovirus cells is...
HLA-G Human
Product Name : HLA-G HumanDescription : HLA-G Human Recombinant produced in E.Coli is a...
HLA-F Human
Product Name : HLA-F HumanDescription : HLA-F Human Recombinant produced in E.Coli is a...
HLA-DRB1 Human
Product Name : HLA-DRB1 HumanDescription : HLA-DRB1 Human Recombinant produced in E.Coli is asingle,...
HLA-DRA Human
Product Name : HLA-DRA HumanDescription : HLA-DRA Human Recombinant produced in E.Coli is a...
ARL15 Human
Product Name : ARL15 HumanDescription : ARL15 Human Recombinant produced in E.coli is a...
HLA-DOB Human
Product Name : HLA-DOB HumanDescription : HLA-DOB Human Recombinant produced in E. coli is...
HLA-DOA Human
Product Name : HLA-DOA HumanDescription : HLA-DOA Human Recombinant produced in E. coli is...
HLA-C Human
Product Name : HLA-C HumanDescription : HLA-C Human Recombinant produced in E.coli is a...
Histone Bovine
Product Name : Histone BovineDescription : Histone Bovine is purified from bovine tissues by...
Hirudin
Product Name : HirudinDescription : Recombinant Hirudin is derived from yeast and the polypeptide...
HINT2 Human
Product Name : HINT2 HumanDescription : HINT2 Human Recombinant produced in E.Coli is a...
HINT1 Human
Product Name : HINT1 HumanDescription : HINT1 Human Recombinant produced in E.Coli is a...
HIF1AN Human
Product Name : HIF1AN HumanDescription : HIF1AN Human Recombinant produced in E.Coli is a...
HIF1A Human, His
Product Name : HIF1A Human, HisDescription : HIF1A Recombinant Human produced in E.Coli is...
HIF1A Human (85 a.a.)
Product Name : HIF1A Human (85 a.a.)Description : HIF1A Recombinant Human produced in E.Coli...
ARL14 Human
Product Name : ARL14 HumanDescription : ARL14 Human Recombinant produced in E.Coli is a...
ACTN1 Human
Product Name : ACTN1 HumanDescription : ACTN1 Human Recombinant produced in E.Coli is a...
A2LD1 Human
Product Name : A2LD1 HumanDescription : A2LD1 Human Recombinant fused with a 20 amino acid...
Stern blot detection of Pgp, MRP1 and BCRP on DRM extracts.
Stern blot detection of Pgp, MRP1 and BCRP on DRM extracts. Flotillin expression was...
S with fibrogenic cytokines, a phenomenon that we have showed to
S with fibrogenic cytokines, a phenomenon that we’ve got showed to be correlated with...
Fers for the point of initially injection of sodium taurocholate. The
Fers for the point of initially injection of sodium taurocholate. The time ourse of...
D adverse events involve close patient follow-up along with the administration of
D adverse events involve close patient follow-up and also the administration of high-dose systemic...
Of the interface in between the tumor and surrounding tissues, and hence
On the interface involving the tumor and surrounding tissues, and as a result are...
Sues including brain, pituitary, and posterior intestine, prlra and prlrb
Sues such as brain, pituitary, and posterior intestine, prlra and prlrb were expressed at...
Residues Phe82, Leu83/Cys83, His84/Asp84 and the interaction ofphenylacetamide moiety
Residues Phe82, Leu83/Cys83, His84/Asp84 and also the interaction ofphenylacetamide moiety with Ile10. The hydrophobic...
A complete array of signal cascades play a key role in
A whole array of signal cascades play a essential part in driving and regulating...
F SIV-specific CD4 + and CD8 + T cells.28 The result we obtained
F SIV-specific CD4 + and CD8 + T cells.28 The outcome we obtained using...
Numbers of mock-infected and TB40/E-infected monocytes (see above) were placed
Numbers of mock-infected and TB40/E-infected monocytes (see above) had been placed in culture with...
F glucagon in sufferers with type-I diabetes who have no beta-cell
F glucagon in sufferers with type-I diabetes who’ve no beta-cell function but nonetheless exhibit...
Atalytic domains of epidermal development aspect receptor (EGFR), HER2 and HER
Atalytic domains of epidermal growth factor receptor (EGFR), HER2 and HER4 which has exhibited...
two CA19.9 + AGR2 + LOXL2 CA19.9 + AGR2 CA19.9 SYCN + REG1B + LOXL2 SYCN
two CA19.9 + AGR2 + LOXL2 CA19.9 + AGR2 CA19.9 SYCN + REG1B +...
The threshold, the cells utilized oleic acid. Nonetheless, the consumption started
The threshold, the cells utilized oleic acid. Even so, the consumption began instantly in...
Ses adjusted for estimated glomerular filtration price (eGFR; calculated by the
Ses adjusted for estimated glomerular filtration price (eGFR; calculated by the MDRD [Modification of...
Yeloid-Specific PHD2-Deficient MicePHD2 expression in a variety of organs from control and
Yeloid-Specific PHD2-Deficient MicePHD2 expression in different organs from control and MyPHD2KO mice had been...
Ory at www.jacionline.org for the clinical qualities of those
Ory at www.jacionline.org for the clinical traits of those subjects). We located that 5...
Ht cycle. Ten- to 12-week-old animals had been used for wound healing
Ht cycle. Ten- to 12-week-old animals were utilised for wound healing experiments as previously...
Se Committee of the San Raffaele Scientific Institute (IACUC 324, 335, 446, 447).Author contributionsASP
Se Committee in the San Raffaele Scientific Institute (IACUC 324, 335, 446, 447).Author contributionsASP,...
And in breastfed infants. Right here, we present proof that XO is
And in breastfed infants. Right here, we present evidence that XO is released from...
Riate correlation structure among the repeated measurements. The delta strategy is
Riate correlation structure among the repeated measurements. The delta method is once more used...
Advertisements to persistent DNA damage that causes premature cellular senescence and
Advertisements to persistent DNA damage that causes premature cellular senescence and reduced proliferation of...
Rved PCE dechlorination activity is due to a cellular Rdh activity
Rved PCE dechlorination activity is due to a cellular Rdh activity and to not...
10, 15 and 20 years, respectively), with multivariate analysis showing that relapses had been much more
ten, 15 and 20 years, respectively), with multivariate evaluation displaying that relapses have been...
Ted glucose (2H2-glucose), or heavy water (2H2O). Despite the fact that these
Ted glucose (2H2-glucose), or heavy water (2H2O). Despite the fact that these strategies are...
Ximately 200 tires (2500 m2). Bait stations had been placed along the perimeter of
Ximately 200 tires (2500 m2). Bait stations were placed along the perimeter from the...
Tter) to compared CRBN- patients (LD cohort 79 vs. 33 , respectively; P=0.005) (TD
Tter) to compared CRBN- patients (LD cohort 79 vs. 33 , respectively; P=0.005) (TD...
Its key inactive metabolites, BE, EME, and ecgonine (Table 1). Furthermore, like
Its important inactive metabolites, BE, EME, and ecgonine (Table 1). Furthermore, like 2E2, h2E2...
Osure to HIV-1 coat protein gp120.25, 26 Tat and gp120 induce autophosphorylation
Osure to HIV-1 coat protein gp120.25, 26 Tat and gp120 induce autophosphorylation of MLK3...
Presence of LMP1 (Fig. 1B). Of note, the low or undetectable
Presence of LMP1 (Fig. 1B). Of note, the low or undetectable LMP1 levels in...
MC simulation. We located that the Markov chains mixed quite effectively
MC simulation. We found that the Markov chains mixed incredibly well and found no...
By the “glomerular filtration barrier” (GFB), which consists of the glomerular
By the “glomerular filtration barrier” (GFB), which consists on the glomerular capillary endothelium, the...
Les and a vortex phenotype (not shown), also as a
Les and also a vortex phenotype (not shown), also as a comma phenotype in...
Ildtype Wildtype (-CD8) RON-KD RON-KD (-CD8) 10 20 30 Time (days) 40 9/10 10/10 5/11 10/10 Experiment-2 14/15 15/15 6/17 14/Transplanted Fibrosarcoma
Ildtype Wildtype (-CD8) RON-KD RON-KD (-CD8) ten 20 30 Time (days) 40 9/10 10/10...
Ce numbers or demographics were not collected for any with the
Ce numbers or demographics were not collected for any of your events. In these...
Ts was also assessed. The K211N, T240R, C352G
Ts was also assessed. The K211N, T240R, C352G, T415N and G430D mutations exhibited deficient...
Those at which the combination treatment results in more activation than
Those at which the mixture remedy final results in extra activation than either drug...
Zymes by the presence of a strictly conserved signature sequence [20,44]. This
Zymes by the presence of a strictly conserved signature sequence . This stretch of...
H) to kind neurospheres (45).ReagentsDilutions of LPA (Sigma-Aldrich, Castle Hill, Australia
H) to form neurospheres (45).ReagentsDilutions of LPA (Sigma-Aldrich, Castle Hill, Australia) have been created...
Duced. Moreover, in treated fibers nucleoli labeled substantially additional intensely than
Duced. Moreover, in treated fibers nucleoli labeled a great deal a lot more intensely...
Productive remedy for patients with sophisticated HCC, the longterm postoperative prognosis
Effective remedy for individuals with sophisticated HCC, the longterm postoperative prognosis remains poor because...
A are presented as the imply .D. of 3 experiments. *Po
A are presented as the mean .D. of three experiments. *Po0.05 versus manage. #...
Vasotec, Merck), the ethyl ester prodrug is metabolically converted by esterases
Vasotec, Merck), the ethyl ester prodrug is metabolically converted by esterases to a free...
Ine (mg/dL)In-Hospital PCISexMaleFemaleRaceWhite/CaucasianInt J Cardiol. Author manuscript; out there
Ine (mg/dL)In-Hospital PCISexMaleFemaleRaceWhite/CaucasianInt J Cardiol. Author manuscript; offered in PMC 2014 September 20. 0.Black/African-AmericanOtherEducation...
At rest no abnormalities are located on neurologic examination. Weakness and
At rest no abnormalities are identified on neurologic examination. Weakness and stiffness invariably appear...
Uation. In consequence, we did not construct concentration-response curves for PPADS
Uation. In consequence, we did not construct concentration-response curves for PPADS at the binding...
Yoneshiro et al.,57 which was related with3adrenoceptor stimu-FFDG uptake and
Yoneshiro et al.,57 which was related with3adrenoceptor stimu-FFDG uptake plus the measured rise in...
DICCCOL landmarks in the model subjects within the group. five. For every single
DICCCOL landmarks in the model subjects within the group. 5. For each and every...
. Pregnancy or lactation. two. Significant hypercalcemia [serum calcium 11.0 mg/dL (2.75 mmol/L
. Pregnancy or lactation. two. Important hypercalcemia or...
In cmt3 and drm2, respectively (Figure two). These data recommend that VIM
In cmt3 and drm2, respectively (Figure 2). These data recommend that VIM and MET1...
Li Y: Degradation of trace nitrobenzene in water by microwave-enhanced H
Li Y: Degradation of trace nitrobenzene in water by microwave-enhanced H2O 2-based approach. Frontenviron...
Consisting of a partially degraded substrate that remains associated with ClpXP
Consisting of a partially degraded substrate that remains related with ClpXP and is paused...
Ined, which was incredibly close to the predicted value of 95.09 . As
Ined, which was quite close for the predicted worth of 95.09 . As for...
Ly ameliorated the memory deficits of Flinders Sensitive Line rats in
Ly ameliorated the memory deficits of Flinders Sensitive Line rats in the object recognition...
Because the mean SEM. 0.01 compared together with the differentiated control.2.0 Normalized fold
Because the mean SEM. 0.01 compared with all the differentiated manage.two.0 Normalized fold alter...
S showed a sturdy colocalization involving inducible and constitutive factor binding
S showed a strong colocalization amongst inducible and constitutive element binding web-sites in pDHSs,...
Ers (oppC, oppB, oppD, and oppF), and two genes involved in
Ers (oppC, oppB, oppD, and oppF), and two genes involved in intracellular peptidase activity...
With regard to this, the present study focused on purification and
With regard to this, the present study focused on purification and characterization of l-asparaginase...
To efficacy and treatment-related toxicities. There’s no alter in the
To efficacy and treatment-related toxicities. There is no transform through the former guideline, as...
Nding. CSW has been a paid consultant for Lundbeck and Roche.
Nding. CSW has been a paid consultant for Lundbeck and Roche. PRS has received...
Et al., 1997), 0.01 (Grung and Metzger, 1994), 0.23 (Lim et al., 2018), and 0.30 (Qin et
Et al., 1997), 0.01 (Grung and Metzger, 1994), 0.23 (Lim et al., 2018), and...
Min. The pellets had been applied for `anchored’-NET estimation (A, B
Min. The pellets have been applied for `anchored’-NET estimation (A, B), and the supernatants...
And over-expression of BCRABL, too as some BCR BL-independent pathways.
And over-expression of BCRABL, at the same time as some BCR BL-independent pathways. Consequently,...
His study. Due to the fact earlier research have demonstrated that elevated protein degradation
His study. Due to the fact previous research have demonstrated that increased protein degradation...
(as bromoplumbates) in the absence of carboxylic acids because the ligands.
(as bromoplumbates) inside the absence of carboxylic acids because the ligands. For the exact...
Vely. Having said that, their tensile specimens (45 mm 7 mm 0.5 mm) were considerably smaller sized
Vely. Having said that, their tensile specimens (45 mm 7 mm 0.five mm) had...
N utilizing an antibody against PGC-1 to evaluate acetylation levels. (D
N applying an antibody against PGC-1 to evaluate acetylation levels. (D) Heatmap depicting mRNA...
E related towards the stiffness on the resulting composites [46]. To be
E connected to the stiffness on the resulting composites . To become certain, the...
Liferation of cartilage (arrow) within the limited reactive bone. (H E
Liferation of cartilage (arrow) inside the limited reactive bone. (H E; 40x).Immunochemical staining for...
G/mL in 50 mannitol). Then, we added 1.7 mL of acetonitrile to
G/mL in 50 mannitol). Then, we added 1.7 mL of acetonitrile to the mixture...
-1 (Sirt1) are also involved inside the regulation in the AMPK-PGC-
-1 (Sirt1) are also involved within the regulation on the AMPK-PGC-1-TFAM axis and, in...
Or at least 24 hours at 10 UPMC neighborhood hospitals, May well 1, 2018 by way of August
Or no less than 24 hours at ten UPMC neighborhood hospitals, May well 1,...
Expression, the A549 cells were pretreated with siNS1 for 6 h and
Expression, the A549 cells had been pretreated with siNS1 for 6 h and then...
Systemic vascular dysfunction [17]. The loss on the ESL or its components
Systemic vascular dysfunction . The loss of your ESL or its components leads to...
Opoiesis by upregulating the JAK2/STAT5 and MAPK/ERK pathways. In
Opoiesis by upregulating the JAK2/STAT5 and MAPK/ERK pathways. Within this study, the core genes...
G at experimental groups. Nonetheless, weight and coefficient in rats in
G at experimental groups. Having said that, weight and coefficient in rats inside the...
D reagents, materials, analysis tools or data; Wrote the paper. Shouman
D reagents, materials, analysis tools or data; Wrote the paper. Shouman Wang: Performed the...
To Tracker Merge Mito Sox Mito Tracker MergeSUN et al.(A
To Tracker Merge Mito Sox Mito Tracker MergeSUN et al.(A)(C)Mito Sox intensity / Mito...
) Re-ligation of G-segment. (7) Opening of C-gate and passage of T-segment and
) Re-ligation of G-segment. (7) Opening of C-gate and passage of T-segment and release...
Vartis, and Sanofi. TW has received travel support from Novartis and
Vartis, and Sanofi. TW has received travel assistance from Novartis and Sanofi and study...
Ein wheat showed a greater content of starch than that with
Ein wheat showed a larger content of starch than that using a low- or...
Lle, IL) blinded for the therapy received ahead of surgery, completed the
Lle, IL) blinded towards the therapy received prior to surgery, completed the analyses. Hematoxylin...
Leterious impact on functions (polyphen score 0.15 and 0.15 and SIFT 0.05) were retained
Leterious effect on functions (polyphen score 0.15 and 0.15 and SIFT 0.05) have been...
S equivalents of malondialdehyde (MDA), employing 1,1,3,3-tetramethoxypropane as normal [17]. The total
S equivalents of malondialdehyde (MDA), employing 1,1,three,3-tetramethoxypropane as common . The total amount of...
Pressed inside the old eACs). Conversely, ADAMTS5 (respectively elevated in old
Pressed within the old eACs). Conversely, ADAMTS5 (respectively improved in old eACs compared with...
Atients in HCC group, 72 were treated with SOF+DAC+RBV, 15 with
Atients in HCC group, 72 have been treated with SOF+DAC+RBV, 15 with SOF+DAC, 11...
I Important Laboratory of Breast Cancer (grant no. 12DZ2260100), plus the
I Key Laboratory of Breast Cancer (grant no. 12DZ2260100), plus the Clinical Analysis Plan...
Have been initially misdiagnosed with other dermatoses, the stage of MF at
Had been initially misdiagnosed with other dermatoses, the stage of MF at initiation of...
Henotype and central memory phenotype). There is no considerable difference in
Henotype and central memory phenotype). There isn’t any substantial distinction within the typical percentage...
S have declared that they have no monetary relationships at present
S have declared that they have no monetary relationships at present or inside the...
Erate in severity. Extreme AEs had been reported in 27 (29 ) sufferers. Essentially the most
Erate in severity. Extreme AEs were reported in 27 (29 ) individuals. By far...
, organic and phenolic compounds, heavy metals, and active pharmaceutical compounds as
, organic and phenolic compounds, heavy metals, and active pharmaceutical compounds as anti-inflammatory and...
Peptides including substance P, VIP or histamine may possibly play a
Peptides for instance substance P, VIP or histamine may play a more predominant function...
Iet could in the OC mice in the OC group have been
Iet could from the OC mice in the OC group have been observed. In...
Ng and simulation-based approaches to investigate the crucial options of this
Ng and simulation-based approaches to investigate the crucial capabilities of this strain that result...
Rators: (i) 1 x, 2 y, ; (ii) , 1 y, .respectively), but is additional downeld
Rators: (i) 1 x, two y, ; (ii) , 1 y, .respectively), but is...
Irus illness 2019 (COVID-19) infection. The effectiveness of anti-viral, immunomodulatory, and anti-inflammatory
Irus disease 2019 (COVID-19) infection. The effectiveness of anti-viral, immunomodulatory, and anti-inflammatory drugs remains...
Pretreated with radical prostatectomy/Ga-RP) with relation to PSA.PSA (ng
Pretreated with radical prostatectomy/Ga-RP) with relation to PSA.PSA (ng/mL) Quantity (x/89) patient group Ga-RP...
Mail None declared Paolo Bellavite features a consultancy agreement with Vanda
Mail None declared Paolo Bellavite features a consultancy agreement with Vanda s.r.l. (Frascati, Rome)....
PLEs (low-PLEs group, 77.9 ). Three-dimensional wisdom total score was lower within the
PLEs (low-PLEs group, 77.9 ). Three-dimensional wisdom total score was reduced inside the high-PLEs...
Ectively. Only a few of Only a number of the signifiels are terms
Ectively. Only some of Only some of the signifiels are terms of upregulated and...
40 30 20 10Time: – 12w-BL4wEOTFUFUFUFigure 3. Kinetics of HBV-DNA, HBsAg and ALT across
40 30 20 10Time: – 12w-BL4wEOTFUFUFUFigure three. Kinetics of HBV-DNA, HBsAg and ALT across...
Aviorsmechanical andeven 24 h just after chemokine administration. ulation, intrathecally causes had been observed
Aviorsmechanical andeven 24 h right after chemokine administration. ulation, intrathecally causes had been observed...
Y at time of blood culture positivity (n = 203).Accelerate Pheno Outcomes
Y at time of blood culture positivity (n = 203).Accelerate Pheno Outcomes in BSIs...
According to the data obtained, the selected value was 35.55, which presented
In line with the information obtained, the selected value was 35.55, which presented the...
Homing assay for HUVECs and BMSCs, transwell migration tests (Corning Costar
Homing assay for HUVECs and BMSCs, transwell migration tests (Corning Costar, America) had been...
Details (ESI) accessible. See DOI:Fig.These authors contributed equally.DTC-modified
Details (ESI) obtainable. See DOI:Fig.These authors contributed equally.DTC-modified cellulose-based sorbents for the selective removal...
Ed to attain 95 probability of 50 maximal inhibition and was applied as
Ed to attain 95 probability of 50 maximal inhibition and was utilized because the...
Fat pad of each and every female BALB/c mouse (5×105 cells/mouse
Fat pad of every single female BALB/c mouse (5×105 cells/mouse). The animal experiment lasted...
Ed Consent Statement: Not applicable. Data Availability Statement: Not applicable. Acknowledgments
Ed Consent Statement: Not applicable. Information Availability Statement: Not applicable. Acknowledgments: Consejo Nacional de...
Divide is linked to the status of their telomeres. Telomeric DNA
Divide is linked towards the status of their telomeres. Telomeric DNA shortens in the...
Re at minuteProstaglandins Leukot Essent Fatty Acids. Author manuscript; available in
Re at minuteProstaglandins Leukot Essent Fatty Acids. Author manuscript; obtainable in PMC 2022 May...
(2 and three) or Reaction (four) occurs with the the excess of acids or
(two and three) or Reaction (four) occurs with all the the excess of acids...
And sucrose (126.8 9.1 mg/g) [42] (Figure 1). 1).Figure 1. Identified molecules by gas chromatography
And sucrose (126.eight 9.1 mg/g) (Figure 1). 1).Figure 1. Identified molecules by gas...
He important supply of active TGF by means of GARP-mediated latent TGF maturation.
He major source of active TGF by way of GARP-mediated latent TGF maturation.20 27...
IGURE four | Frequency of exhausted and terminally differentiated cells amongst CD39+ Vd
IGURE four | Frequency of exhausted and terminally differentiated cells amongst CD39+ Vd1 versus...
) for (A) BCTscore candidate 2 (BCTscore two) and the BCT biomarkers (B) NLR
) for (A) BCTscore candidate two (BCTscore 2) as well as the BCT biomarkers...
Speed was steadily increased from 5 to 75 rpm at area temperature. The
Speed was steadily increased from five to 75 rpm at space temperature. The formulation...
From An-Nan Hospital, China Health-related University, Tainan, Taiwan; CMRC-CMA-2 from Greater
From An-Nan Hospital, China Healthcare University, Tainan, Taiwan; CMRC-CMA-2 from Greater Education Sprout Project...
CellsTo address the mechanisms leading to selective cerebellar neurodegeneration we performed
CellsTo address the mechanisms major to selective cerebellar neurodegeneration we performed a detailed evaluation...
Mutations scattered at all distinct functional domains (Gla, EGF1, EGF2 and
Mutations scattered at all distinct functional domains (Gla, EGF1, EGF2 and catalytic domains) have...
RelapsesRelapse was diagnosed when patients presented with exact same or related symptoms
RelapsesRelapse was diagnosed when patients presented with same or related symptoms as baseline and...
On alone group, suggesting that MV soon after PA instillation induces lung
On alone group, suggesting that MV immediately after PA instillation induces lung injury by...
four ranks (three, two, 1, and 0) from higher to low according to phenotypic modifications according
4 ranks (3, two, 1, and 0) from high to low based on phenotypic...
Discovering was that the breathing sound of your left lung was
Obtaining was that the breathing sound of your left lung was low and the...
T inside the propria, attributed epithelial necrosis manage group (Figure 3De
T inside the propria, attributed epithelial necrosis manage group (Figure 3De,k). control5138Viruses 2015, 7,...
1. Using its numerous functional domains, UHRF1 creates a strong coordinated dialogue
1. Applying its various functional domains, UHRF1 creates a robust coordinated dialogue between DNA...
Gh release of eotaxin that induces a subsequent marked infiltration of
Gh release of eotaxin that induces a subsequent marked infiltration of eosinophils within the...
Rin therapy eliminates detectable HCV in some sufferers, but unwanted side effects
Rin therapy eliminates detectable HCV in some individuals, but negative effects are worse than...
S, metal import need to raise accordingly for cell survival. Some portion
S, metal import must improve accordingly for cell survival. Some portion of such intracellular...
E show that the levels of mature mir-155 have been also improved
E show that the levels of mature mir-155 were also enhanced in RA SFM...
Urine specimens for UIC. Given the critical roleAuthor Manuscript Author Manuscript
Urine specimens for UIC. Provided the important roleAuthor Manuscript Author Manuscript Author Manuscript Author...
Id ahead of injection. Homogenized feces pooled samples (06 h for [14C]-FTD
Id just before injection. Homogenized feces pooled samples (06 h for -FTD, and 020...
Hmaniasis Care in MoroccoTable 1. Demographic Facts and data on diagnosis and
Hmaniasis Care in MoroccoTable 1. Demographic Information and facts and information on diagnosis and...
We co-cultured them with labeled CD8+ na e T cells and
We co-cultured them with labeled CD8+ na e T cells and measured cytokine secretion...
Ulating inflammatory biomarker. General population-based research of inflammatory markers and anxiety
Ulating inflammatory biomarker. Common population-based research of inflammatory markers and anxiety disorder are scarce....
Presence of water and digestive fluids as a result of the presence of
Presence of water and digestive fluids as a consequence of the presence of ionic...
Lain the lack of correlation in between chemical shifts and structure. The
Lain the lack of correlation among chemical shifts and structure. The obtained information indicated...
Binds to LRP5/6 and Kremen1/2, which inhibits canonical Wnt signal and
Binds to LRP5/6 and Kremen1/2, which inhibits canonical Wnt signal and so prevents -catenin...
An authorities have really not too long ago authorized the use of Daclatasvir for
An authorities have extremely lately approved the usage of Daclatasvir for the treatment of...
In DFMO low dose therapy groups. As anticipated, higher dose DFMO
In DFMO low dose remedy groups. As expected, higher dose DFMO totally suppressed adenoma...
F the underlying mechanisms of apoptosis, we then examined early apoptosis
F the underlying mechanisms of apoptosis, we then examined early apoptosis in HT-2 treated...
Radiation. The CHS response was measured. Significant enhance in CHS response
Radiation. The CHS response was measured. Considerable improve in CHS response (groups 4 and...
Hours right after NMDA application. For thePLOS One | DOI:10.1371/journal.pone.0144806 December
Hours right after NMDA application. For thePLOS 1 | DOI:10.1371/journal.pone.0144806 December 14,8 /Effect of...
Ected the information and contributed to writing the paper; SS, NG
Ected the data and contributed to writing the paper; SS, NG and FC collected...
That YAP utilizes to exert its oncogenic functions, while clarifying misconceptions
That YAP utilizes to exert its oncogenic functions, although clarifying misconceptions with the previous....
Nhibitor of PKC and down-regulation in the enzyme by siRNA blocked
Nhibitor of PKC and down-regulation on the enzyme by siRNA blocked the potential of...
Onone, and camphene had been feeding deterrents that brought on a reduction in
Onone, and camphene have been feeding deterrents that brought on a reduction inside the...
Re is actually a lack of evidence of a definite all round survival
Re is usually a lack of evidence of a definite general survival (OS) benefit...
On Medical Devices, Inc., Plano, TX). Following local anesthesia with 2 mL
On Medical Devices, Inc., Plano, TX). Following neighborhood anesthesia with two mL of 1...
He assumption that recreational use of PCNBSS began in 1970s and
He assumption that recreational use of PCNBSS started in 1970s and 1980s when these...
Hology of electrodeposited films and produce electrodes with enantiomeric selectivity.35 Nonetheless
Hology of electrodeposited films and develop electrodes with enantiomeric selectivity.35 Nonetheless, ahead of our...
S response seems to display other exceptional traits and adaptations in the course of
S response seems to show other unique characteristics and adaptations in the course of...
That the scale-up of WASH interventions as tools for STH handle
That the scale-up of WASH interventions as tools for STH handle isn’t probably to...
Reptavidin Cy-3 (BD Biosciences) was added to PBS (pH 7.5) and incubated
Reptavidin Cy-3 (BD Biosciences) was added to PBS (pH 7.five) and incubated overnight at...
Ession cDNA was analyzed as per the manufacturer recommendation within the
Ession cDNA was analyzed as per the manufacturer recommendation within the TaqMan Array for...
Analyses and mixed linear modelsNone of your sensitivity analyses influence within
Analyses and mixed linear modelsNone in the sensitivity analyses influence inside group comparisons post-exercise....
Ccuracy RE( ) 3.85 -0.73 -0.18 -4.02 0.89 1.26 -2.61 -1.81 -2.07 Precision RSD( ) six.04 1.24 2.02 three.76 4.21 3.93 2.05 three.01 two.11 Measured
Ccuracy RE( ) 3.85 -0.73 -0.18 -4.02 0.89 1.26 -2.61 -1.81 -2.07 Precision RSD(...
Ng. The volume of the DNA needed for every single group was
Ng. The volume on the DNA essential for every single group was calculated determined...
Ed T cells, we performedintracellular staining of cytotoxic variables perforin and
Ed T cells, we performedintracellular staining of cytotoxic components perforin and granzyme B, and...
S only variables significantly connected with risk of discontinuation ATC Anatomical
S only variables substantially connected with risk of discontinuation ATC Anatomical Therapeutic Chemical, CI...
Of Aza (from 1 M to 15 M). The results show a dose-dependent
Of Aza (from 1 M to 15 M). The outcomes show a dose-dependent enhancement...
Medium was replaced with CCM DS or FDM containing logarithmic increments
Medium was replaced with CCM DS or FDM containing logarithmic increments of BPA from...
Iferative activities in various cancer models.19,20 WA targets the tumor proteasome
Iferative activities in several cancer models.19,20 WA targets the tumor proteasome, which results in...
Primarily based study at Kings College Hospital, London [47]. For any 5 false-positive price
Primarily based study at Kings College Hospital, London . To get a 5 false-positive...
Ality all through the therapy period, as measured by the patient functionality
Ality all through the treatment period, as measured by the patient functionality questionnaire. The...
/- -/-/- -/-/-/-/- -/-
/- -/-/- -/-/-/-/- -/-/- -/-/- -/-/- -/-/-/-/- -/-/- -/-/- -/-/- -/-/-/-/- -/-/- -/-/- -/-/-...
Racerebroventricular (i.c.v.) administration of L-Arg or L-NAME on NO
Racerebroventricular (i.c.v.) administration of L-Arg or L-NAME on NO content and 7 nAChR expression...
482) have been utilised in preparation on the HPLC mobile phase. Forced degradation
482) were made use of in preparation on the HPLC mobile phase. Forced degradation...
Cluding inflammatory cytokines, chemokines, and adhesion molecules.13,22 Despite the fact that Dimethyl fumarate stabilizes
Cluding inflammatory cytokines, chemokines, and adhesion molecules.13,22 Although Dimethyl fumarate stabilizes Nrf2, the role...
Ed clinical trials in oncology. Measuring OS as an endpoint inEd clinical trials in oncology.
Ed clinical trials in oncology. Measuring OS as an endpoint inEd clinical trials in...
Tissue homogenates making use of a commercial CS assay kit (Sigma). Tissue and
Tissue homogenates using a commercial CS assay kit (Sigma). Tissue and C2C12 cell NAD+...
0-6700) 14.0 (13.1-14.eight) 13.9 (13.0-14.9) 15.0 (12.3-19.7) 15.4 (12.9-20.3) 61/16 13/14 Odds ratio (95 CI) 7.739 (two.111-28.375)NS NS
0-6700) 14.0 (13.1-14.8) 13.9 (13.0-14.9) 15.0 (12.3-19.7) 15.4 (12.9-20.3) 61/16 13/14 Odds ratio (95...
Ter at 15, 30, 60, 90, 120, 240, and 480 min soon after the dose was administered and processed
Ter at 15, 30, 60, 90, 120, 240, and 480 min following the dose...
Even uponPLOS Genetics | DOI:ten.1371/journal.pgen.June 19,ten /DNA Harm Regulates Translation
Even uponPLOS Genetics | DOI:10.1371/journal.pgen.June 19,10 /DNA Damage Regulates Translation via -TRCP Targeting of...
Sfer of antigen-loaded or viral vector ransduced DCs. DC-targeted LV vaccines
Sfer of antigen-loaded or viral vector ransduced DCs. DC-targeted LV vaccines are under clinical...
, miRNA-mediated gene silencing and proteasomal degradation, either of which may cause
, miRNA-mediated gene silencing and proteasomal degradation, either of which can cause loss of...
On benefits, respectively (original magnification 00).optimistic for IgE. Most of the
On benefits, respectively (original magnification 00).constructive for IgE. The majority of the IgE good...
Gd-IgA1 than do the cells from HCs, concordantly together with the serum
Gd-IgA1 than do the cells from HCs, concordantly with all the serum levels of...
. qPCR 2. FISHEvaluation The sequencing of cDNA from tumor tissues in comparison to
. qPCR two. FISHEvaluation The sequencing of cDNA from tumor tissues when compared with...
Optimization on the chloramphenicol resistance gene (cat) and an improvement of
Optimization with the chloramphenicol resistance gene (cat) and an improvement from the previously utilised...
Ting point estimates and 95 CIs. PFS was defined as the time
Ting point estimates and 95 CIs. PFS was defined as the time among randomisation...
Of Kibra to Hippo signaling came via a genetic screen for
Of Kibra to Hippo signaling came through a genetic screen for oocyte polarity mutants...
FTY720 induced apoptosis (i.e. decrease IC50) (Figure 3J), suggesting that
FTY720 induced apoptosis (i.e. reduce IC50) (Figure 3J), suggesting that the capacity for FTY720...
HRV between manage and baseline was important (P 0.05).Table 4. Correlations amongst
HRV between manage and baseline was important (P 0.05).Table four. Correlations among endocrine variables...
The lanes correspond towards the numbers of your constructs shown on
The lanes correspond for the numbers of your constructs shown on the left in...
Ed analysis. Limited information on incidence of AF had been accessible inEd evaluation. Limited data
Ed analysis. Limited information on incidence of AF had been accessible inEd evaluation. Limited...
Ript[1][2]In the experiments described here, [X-]T was usually [heme-XRipt[1][2]In the experiments described right here,
RiptIn the experiments described here, T was usually In the experiments described right here,...
Is setting (Table three).9502 mTORC1/mTORC2 kinase domain inhibitors95,10305: mTORC1 controls cellIs setting (Table 3).9502 mTORC1/mTORC2
Is setting (Table three).9502 mTORC1/mTORC2 kinase domain inhibitors95,10305: mTORC1 controls cellIs setting (Table 3).9502...
Flap model doesn't totally reflect the ischemic situations that prevailFlap model does not completely reflect
Flap model doesn’t totally reflect the ischemic situations that prevailFlap model does not completely...
K treatment (0.625sirtuininhibitor ) as compared with vehicle-treated controls (Figure 1D). TogetherK remedy
K treatment (0.625sirtuininhibitor ) as compared with vehicle-treated controls (Figure 1D). TogetherK remedy (0.625sirtuininhibitor...
, 33-cGAMP was added inside the chase medium. At the finish of, 33-cGAMP was added
, 33-cGAMP was added inside the chase medium. At the finish of, 33-cGAMP was...
DK19 cells (Fig. 7A). These results are in agreement with priorDK19 cells (Fig. 7A). These
DK19 cells (Fig. 7A). These results are in agreement with priorDK19 cells (Fig. 7A)....
Fficiently GSTP1 Protein custom synthesis powered to detect clinically meaningful associations.ResultsThere have been 31 individuals
Fficiently GSTP1 Protein custom synthesis powered to detect clinically meaningful associations.ResultsThere have been 31...
Uda and Seckl 2011). Since we did not sample blood at shorterUda and Seckl 2011).
Uda and Seckl 2011). Since we did not sample blood at shorterUda and Seckl...
ST6GAL1, Mouse (HEK293, His) Rmined because the point of departure at a benchmark response ofRmined
ST6GAL1, Mouse (HEK293, His) Rmined because the point of departure at a benchmark response...
Rhinitis, and groups C (n = ten, asthma/rotatory control) and D (nRhinitis, and groups C
Rhinitis, and groups C (n = ten, asthma/rotatory control) and D (nRhinitis, and groups...
Estions for reference for the clinician.Sensory neuropathies have emerged asEstions for reference for the clinician.Sensory
Estions for reference for the clinician.Sensory neuropathies have emerged asEstions for reference for the...
Ermined the IgG1 and IgG2c subtype levels in zE-specific IgGsErmined the IgG1 and IgG2c subtype
Ermined the IgG1 and IgG2c subtype levels in zE-specific IgGsErmined the IgG1 and IgG2c...
Rment individuals. 259-266 22 Aizu Y, Oyanagi K, Hu J, Nakagawa H.Rment patients. 259-266 22
Rment individuals. 259-266 22 Aizu Y, Oyanagi K, Hu J, Nakagawa H.Rment patients. 259-266...
Owth of SIRT6high and SIRT6 WT lines. Similarly, elevated proteinOwth of SIRT6high and SIRT6 WT
Owth of SIRT6high and SIRT6 WT lines. Similarly, elevated proteinOwth of SIRT6high and SIRT6...
Igital cameras mounted inside the center of every single side of yourIgital cameras mounted within
Igital cameras mounted inside the center of every single side of yourIgital cameras mounted...
OA1, and total ApoA1 concentrations after 4 weeks of a diet plan richOA1, and total
OA1, and total ApoA1 concentrations after 4 weeks of a diet plan richOA1, and...
F a single species should create a consistent profile of coreF a single species ought
F a single species should create a consistent profile of coreF a single species...
Lysis confirmed that food supplements containing suitable doses of either berberineLysis confirmed that food supplements
Lysis confirmed that food supplements containing suitable doses of either berberineLysis confirmed that food...
Tuininhibitor00). (E) Pomegranate juice-supplemented group, TGF alpha/TGFA Protein Storage & Stability displaying regular histological structure
Tuininhibitor00). (E) Pomegranate juice-supplemented group, TGF alpha/TGFA Protein Storage & Stability displaying regular histological...
Ity of Colorado Anschutz Healthcare Campus. Oligonucleotide sequences for shRNAs areIty of Colorado Anschutz Healthcare
Ity of Colorado Anschutz Healthcare Campus. Oligonucleotide sequences for shRNAs areIty of Colorado Anschutz...
Ng open-source application, including the FSL Brain Extraction Tool (://fsl.fmrib.Ng open-source software, such as the
Ng open-source application, including the FSL Brain Extraction Tool (://fsl.fmrib.Ng open-source software, such as...
Erature, the microwells were washed to get rid of unbound conjugate. The enzymeErature, the microwells
Erature, the microwells were washed to get rid of unbound conjugate. The enzymeErature, the...
T al., 2000). Then, the general proteolytic activity, in ascending order ofT al., 2000). Then,
T al., 2000). Then, the general proteolytic activity, in ascending order ofT al., 2000)....
Th ten regular goat serum and incubated overnight atFigure two FigureBoNT/A andTh ten
Th ten regular goat serum and incubated overnight atFigure two FigureBoNT/A andTh ten standard...
Rase activity, transport and other metabolic approach (Supplementary Data three). Interestingly, inRase activity, transport and
Rase activity, transport and other metabolic approach (Supplementary Data three). Interestingly, inRase activity, transport...
Dent role for LATS2 in regulating cholesterol homeostasis by restricting theDent function for LATS2 in
Dent role for LATS2 in regulating cholesterol homeostasis by restricting theDent function for LATS2...
Ties were semiquantitatively determined by depositing drops containing serial dilutions ofTies have been semiquantitatively determined
Ties were semiquantitatively determined by depositing drops containing serial dilutions ofTies have been semiquantitatively...
The nanoparticles had been determined by HPLC employing exactly the same process asThe nanoparticles were
The nanoparticles had been determined by HPLC employing exactly the same process asThe nanoparticles...
Sist together with the information extraction and analysis and draft the resultsSist using the data
Sist together with the information extraction and analysis and draft the resultsSist using the...
At deal of study and trials have focused around the pharmacologicalAt deal of study and
At deal of study and trials have focused around the pharmacologicalAt deal of study...
Restingly, analogous findings were created in HCT116 cells upon CDK8 knockdownRestingly, analogous findings have been
Restingly, analogous findings were created in HCT116 cells upon CDK8 knockdownRestingly, analogous findings have...
Volvement of latter pathway in BCWM-1 cells was related with downregulationVolvement of latter pathway in
Volvement of latter pathway in BCWM-1 cells was related with downregulationVolvement of latter pathway...
Bind cyanide 3 to 5 orders of magnitude weaker than wild-typeBind cyanide three to 5
Bind cyanide 3 to 5 orders of magnitude weaker than wild-typeBind cyanide three to...
Xperiments had been compared. p sirtuininhibitor 0.05. (C) Cells have been treated with growingXperiments have
Xperiments had been compared. p sirtuininhibitor 0.05. (C) Cells have been treated with growingXperiments...
And/or IL-13 alone, enhanced MR expression (Fig. 1 K). Accordingly, theAnd/or IL-13 alone, enhanced MR
And/or IL-13 alone, enhanced MR expression (Fig. 1 K). Accordingly, theAnd/or IL-13 alone, enhanced...
Girls within this cohort who had been prescribed and took paroxetine hadWomen within this cohort
Girls within this cohort who had been prescribed and took paroxetine hadWomen within this...
Flammatory response. Evidences inside the literature showed that the phenotype ofFlammatory response. Evidences inside the
Flammatory response. Evidences inside the literature showed that the phenotype ofFlammatory response. Evidences inside...
Tiation. Soon after becoming instructed, these dM will make and keep aTiation. After becoming instructed,
Tiation. Soon after becoming instructed, these dM will make and keep aTiation. After becoming...
Treat populations requiring urgent remedy, like sufferers with ESLD, haveTreat populations requiring urgent remedy, which
Treat populations requiring urgent remedy, like sufferers with ESLD, haveTreat populations requiring urgent remedy,...
Erine/threonine kinase area intervenes between the N-terminal and C-terminal regionsErine/threonine kinase area intervenes among the
Erine/threonine kinase area intervenes between the N-terminal and C-terminal regionsErine/threonine kinase area intervenes among...
E of approximately 10 among those with MDR. XDR TB has nowE of about
E of approximately 10 among those with MDR. XDR TB has nowE of about...
Hereby supplying one particular plausible mechanism by which weight modifications impair fertilityHereby supplying one plausible
Hereby supplying one particular plausible mechanism by which weight modifications impair fertilityHereby supplying one...
Whereas those stained with both Annexin V-APC and PI were regarded asWhereas these stained with
Whereas those stained with both Annexin V-APC and PI were regarded asWhereas these stained...
Therapy of sIgM+/+ mice cause an altered B-2 cell differentiationTherapy of sIgM+/+ mice bring about
Therapy of sIgM+/+ mice cause an altered B-2 cell differentiationTherapy of sIgM+/+ mice bring...
C. Accessible at: www.bioinformatics.babraham.ac.uk/projects/ fastqc/. AccessedC. Offered at: www.bioinformatics.babraham.ac.uk/projects/ fastqc/. Accessed September 11, 2014. 77.
C. Accessible at: www.bioinformatics.babraham.ac.uk/projects/ fastqc/. AccessedC. Offered at: www.bioinformatics.babraham.ac.uk/projects/ fastqc/. Accessed September 11, 2014....
Ery of siRNA (Table 1). Each formulation was then divided into 3Ery of siRNA (Table
Ery of siRNA (Table 1). Each formulation was then divided into 3Ery of siRNA...
Le, which has implications for the development of surrogate clinical markersLe, which has implications for
Le, which has implications for the development of surrogate clinical markersLe, which has implications...
Ience and Biotechnology (2016) 7:Table three Reactive oxygen species (ROS) production by bovineIence and Biotechnology
Ience and Biotechnology (2016) 7:Table three Reactive oxygen species (ROS) production by bovineIence and...
E of such components (outcomes not shown). Additional than half ofE of such components (benefits
E of such components (outcomes not shown). Additional than half ofE of such components...
Xpression in HCL (21 ) and HCL-v (12 ) is slightly greater than in previousXpression
Xpression in HCL (21 ) and HCL-v (12 ) is slightly greater than in...
R enhanced transfection efficiency combined with reduced cytotoxicity as when compared withR enhanced transfection efficiency
R enhanced transfection efficiency combined with reduced cytotoxicity as when compared withR enhanced transfection...
Fficiently powered to detect clinically meaningful associations.ResultsThere were 31 patients whoFficiently powered to detect clinically
Fficiently powered to detect clinically meaningful associations.ResultsThere were 31 patients whoFficiently powered to detect...
Orgensen et al., 2002), comparable to total intracellular methionine concentrations (Table S1). Alterations in thiolated
Orgensen et al., 2002), comparable to total intracellular methionine concentrations (Table S1). Alterations in...
Ted as mean values and their typical deviations (SD) while non-normally distributed information are presented
Ted as mean values and their typical deviations (SD) while non-normally distributed information are...
E youths (Table C, accessible as a supplement for the on the internetE youths (Table
E youths (Table C, accessible as a supplement for the on the internetE youths...
Ry for the phosphorylation of IRS2 by the IR kinase inRy for the phosphorylation of
Ry for the phosphorylation of IRS2 by the IR kinase inRy for the phosphorylation...
Arly as 30 min just after the addition of purified NSP4 and reached a peak
Arly as 30 min just after the addition of purified NSP4 and reached a...
R. Data summarizing the effects of Ndufs4 deletion inthe presence or absence of PJ34 on
R. Data summarizing the effects of Ndufs4 deletion inthe presence or absence of PJ34...
Ree independent experiments. NTC, nontarget manage.Research have indicated the value of PKCa overexpression in defending
Ree independent experiments. NTC, nontarget manage.Research have indicated the value of PKCa overexpression in...
Regulate the activity of telomerase and increase oxidative stress which inRegulate the activity of telomerase
Regulate the activity of telomerase and increase oxidative stress which inRegulate the activity of...
In explosive manner. This nature of seed dispersal mechanism poses aIn explosive manner. This nature
In explosive manner. This nature of seed dispersal mechanism poses aIn explosive manner. This...
Ne was identified in our STM screen as impacting upon virulence (Figure three). PduQ is
Ne was identified in our STM screen as impacting upon virulence (Figure three). PduQ...
Phase, OG was replaced with either OGSA or OGMZ. The microparticles with OGSA and OGMZ
Phase, OG was replaced with either OGSA or OGMZ. The microparticles with OGSA and...
Nally a mechanism linking inflammasome activation for the induction of autophagy was found. The compact
Nally a mechanism linking inflammasome activation for the induction of autophagy was found. The...
Hem. Author manuscript; available in PMC 2014 November 01.Chen et al.PageToHem. Author manuscript; obtainable in
Hem. Author manuscript; available in PMC 2014 November 01.Chen et al.PageToHem. Author manuscript; obtainable...
And female offspring at this time.handle of salt balance laterAnd female offspring at this time.control
And female offspring at this time.handle of salt balance laterAnd female offspring at this...
Umarol to inhibit NQO1 (Fig. 4a). Cytotoxic responses for dC3 micelles in A549 and NQO1+
Umarol to inhibit NQO1 (Fig. 4a). Cytotoxic responses for dC3 micelles in A549 and...
Thane (13 and 14). Initially, we thought that condensation working with ethenes 11 or 12
Thane (13 and 14). Initially, we thought that condensation working with ethenes 11 or...
Amplified these peaks and troughs and gave rise to extremely oillatoryAmplified these peaks and troughs
Amplified these peaks and troughs and gave rise to extremely oillatoryAmplified these peaks and...
And palm kernel oil (247 mg KOH gm) (Pearson, 1976). On the other hand, this
And palm kernel oil (247 mg KOH gm) (Pearson, 1976). On the other hand,...
You get any `flu-like symptoms, don't hesitate to visit the hospital and inform them, inform
You get any `flu-like symptoms, don’t hesitate to visit the hospital and inform them,...
Re capable to remedy the Annexin A2/ANXA2 Protein Formulation disease. Interferon (IFN-) has pleiotropic
Re capable to remedy the Annexin A2/ANXA2 Protein Formulation disease. Interferon (IFN-) has pleiotropic...
D the possibility of contamination was ruled out making use of two damaging samples (sterile
D the possibility of contamination was ruled out making use of two damaging samples...
S in Drosophila eyes triggered by hGBA with RecNciI mutationHere, weS in Drosophila eyes brought
S in Drosophila eyes triggered by hGBA with RecNciI mutationHere, weS in Drosophila eyes...
Ndrial biogenesis. NeitherEnvironmental Health Perspectives volumePM2.five exposure nor CCR2 genotype inducedNdrial biogenesis. NeitherEnvironmental Wellness Perspectives
Ndrial biogenesis. NeitherEnvironmental Health Perspectives volumePM2.five exposure nor CCR2 genotype inducedNdrial biogenesis. NeitherEnvironmental Wellness...
Ion of cardiac KATP channels in intact cells by way of activation of sGC and
Ion of cardiac KATP channels in intact cells by way of activation of sGC...
S have shown that Ikaros upregulates Ebf1 expression (which negatively regulates Blimp-1) (51, 72) and
S have shown that Ikaros upregulates Ebf1 expression (which negatively regulates Blimp-1) (51, 72)...
Nces in half-Ironman triathlon performances - the Ironman 70.three Switzerland from 2007 to 2010. Open
Nces in half-Ironman triathlon performances – the Ironman 70.three Switzerland from 2007 to 2010....
Ka regions.40,41 Prior studies also LIF Protein Species reported larger youth mortality disparities inKa regions.40,41
Ka regions.40,41 Prior studies also LIF Protein Species reported larger youth mortality disparities inKa...
Charged), quick half-life, low oral bioavailability, and gastric negative effects makeCharged), short half-life, low oral
Charged), quick half-life, low oral bioavailability, and gastric negative effects makeCharged), short half-life, low...
Neously converts it twice as follows: (1) cytosines are replaced with thymines, and (2) guanines
Neously converts it twice as follows: (1) cytosines are replaced with thymines, and (2)...
S, the insulinogenicindex tended to increase in parallel with all the statistically important reduce of
S, the insulinogenicindex tended to increase in parallel with all the statistically important reduce...
Ected introns (Fig. 7C). These analyses pointed to a lowered AU richness from the 5=ssto-BrP
Ected introns (Fig. 7C). These analyses pointed to a lowered AU richness from the...
Etween leukocytes TL and physical and sexual abuse in childhood inEtween leukocytes TL and physical
Etween leukocytes TL and physical and sexual abuse in childhood inEtween leukocytes TL and...
On the heteroxylan epitopes that was not apparent for the MLGFrom the heteroxylan epitopes that
On the heteroxylan epitopes that was not apparent for the MLGFrom the heteroxylan epitopes...
Pressed in primary afferent neurons [19,52], supporting a peripheral web site of interaction in between
Pressed in primary afferent neurons , supporting a peripheral web site of interaction in...
Ibition didn't affect the mRNA expression of self-renewal and pluripotency components for instance Nanog, Oct4,
Ibition didn’t affect the mRNA expression of self-renewal and pluripotency components for instance Nanog,...
Gest that transcriptional applications play a crucial part in the segmental also as tissue selective
Gest that transcriptional applications play a crucial part in the segmental also as tissue...
Ns related to our own. The study demonstrated that this cutoffNs comparable to our personal.
Ns related to our own. The study demonstrated that this cutoffNs comparable to our...
Ogorov mirnov test. Variations among age, serum levels of ACTH, cortisol, testosterone, progesterone, and DHEA-S
Ogorov mirnov test. Variations among age, serum levels of ACTH, cortisol, testosterone, progesterone, and...
Logical observation from the residual arterial tissue revealed that the tissue architecture and tunica layering
Logical observation from the residual arterial tissue revealed that the tissue architecture and tunica...
Te-buffered saline (PBS) two occasions to get rid of DMEM medium. Subsequent, the cells have
Te-buffered saline (PBS) two occasions to get rid of DMEM medium. Subsequent, the cells...
Zine 25 to 50 mg PO each and every 4 to 6 hours if needed,
Zine 25 to 50 mg PO each and every 4 to 6 hours if...
Smittance .560 nm) (Eastman Kodak, Rochester, NY). All animal procedures and experimentsSmittance .560 nm) (Eastman
Smittance .560 nm) (Eastman Kodak, Rochester, NY). All animal procedures and experimentsSmittance .560 nm)...
Rmeability may clarify the differential antifungal activity of the propargyl-linked antifolates, we measured MIC values
Rmeability may clarify the differential antifungal activity of the propargyl-linked antifolates, we measured MIC...
Tively bound proteins determined by mass spectrometry have been subjected to functional and pathway analysis.
Tively bound proteins determined by mass spectrometry have been subjected to functional and pathway...
Ture, but it is not a random coil Proteins that form amyloid may be divided
Ture, but it is not a random coil Proteins that form amyloid may be...
In between each OSM, Human (His) insulin treatments had been tested by repeatedmeasures analysis or
In between each OSM, Human (His) insulin treatments had been tested by repeatedmeasures analysis...
Ne on the most important ion peaks in the full MS scanNe in the major
Ne on the most important ion peaks in the full MS scanNe in the...
Ogorov mirnov test. Differences among age, serum levels of ACTH, cortisol, testosterone, progesterone, and DHEA-S
Ogorov mirnov test. Differences among age, serum levels of ACTH, cortisol, testosterone, progesterone, and...
S is accountable for the genetic handle of the volatiles. The additive effect of those
S is accountable for the genetic handle of the volatiles. The additive effect of...
Ompetent state, growing the proportion of SVs in the vicinity in the presynaptic membrane as
Ompetent state, growing the proportion of SVs in the vicinity in the presynaptic membrane...
Tuator vs nonfluctuator groups (p , 0.01). Information comparing the demographic and clinicalTuator vs nonfluctuator
Tuator vs nonfluctuator groups (p , 0.01). Information comparing the demographic and clinicalTuator vs...
S aging-induced cardiac hypertrophy and myocardial contractile function by means of loss ofS aging-induced cardiac
S aging-induced cardiac hypertrophy and myocardial contractile function by means of loss ofS aging-induced...
Om a postmarketing surveillance study.42 In this publication, top quality of life was assessed using
Om a postmarketing surveillance study.42 In this publication, top quality of life was assessed...
Be transactivating EGFR without the need of cleavage, e.g. in a juxtacrine manner, independent of
Be transactivating EGFR without the need of cleavage, e.g. in a juxtacrine manner, independent...
Explained for 90 by the parasympathetic activity as described above, the normalized unit of
Explained for 90 by the parasympathetic activity as described above, the normalized unit of...
Process, at the cellular level, might be viewed as a lifelongProcedure, at the cellular level,
Process, at the cellular level, might be viewed as a lifelongProcedure, at the cellular...
E brought on restoration of epithelial morphology and lowered development in softE brought on restoration
E brought on restoration of epithelial morphology and lowered development in softE brought on...
Rcinoma in the Merge 550 tumor database is correlated with poor survival (P ?0.00399) in
Rcinoma in the Merge 550 tumor database is correlated with poor survival (P ?0.00399)...
Nt in dihydrofolate reductase activity. Proc Natl Acad Sci U S A 1980, 77(7):4216?220. 11.
Nt in dihydrofolate reductase activity. Proc Natl Acad Sci U S A 1980, 77(7):4216?220....
Ion to IL-10 production may also be operational for the regulatory function of Bregs (1-4,
Ion to IL-10 production may also be operational for the regulatory function of Bregs...
Ar, together with the majority falling into this last category (Fig 2). TransplantationAr, with the
Ar, together with the majority falling into this last category (Fig 2). TransplantationAr, with...
With the heteroxylan epitopes that was not apparent for the MLGWith the heteroxylan epitopes that
With the heteroxylan epitopes that was not apparent for the MLGWith the heteroxylan epitopes...
Eukaemia (six), mammary gland (5), prostate (7), lung (eight), head and neck (9), and kidney
Eukaemia (six), mammary gland (5), prostate (7), lung (eight), head and neck (9), and...
T triggers considerable development inhibition in B-cell acute lymphocytic leukemia cells 24. We right here
T triggers considerable development inhibition in B-cell acute lymphocytic leukemia cells 24. We right...
Ll forms from ESCs, such as motoneurons [1,2], dopaminergic neurons [3?], cortical neurons [6], cerebellar
Ll forms from ESCs, such as motoneurons , dopaminergic neurons , cortical neurons ,...
Schedule is indicated in Fig. 7D). More than the treatment period thereSchedule is indicated in
Schedule is indicated in Fig. 7D). More than the treatment period thereSchedule is indicated...
Or x. 2.five. HPLC HPLC evaluation was ALK1 MedChemExpress carried out on Alliance HPLCOr x.
Or x. 2.five. HPLC HPLC evaluation was ALK1 MedChemExpress carried out on Alliance HPLCOr...
Labeled using the hair cell markers Myo7a (cytoplasmic, green) and Gfi1 (nuclear, red). The eminentia
Labeled using the hair cell markers Myo7a (cytoplasmic, green) and Gfi1 (nuclear, red). The...
Icant main effect on chow intake in food-deprived rats (F(3, 18) ?4.two, Po0.02) (see Figure
Icant main effect on chow intake in food-deprived rats (F(3, 18) ?4.two, Po0.02) (see...
Ensembles, and utilized the conformationally sensitive 3J(HNH) continuous on the N-terminal amide proton as a
Ensembles, and utilized the conformationally sensitive 3J(HNH) continuous on the N-terminal amide proton as...
Method, in the cellular level, could be viewed as a lifelongProcedure, at the cellular level,
Method, in the cellular level, could be viewed as a lifelongProcedure, at the cellular...
Tial amino acids Alanine Ornithine Asparagine Aspartate Cysteine Glutamate Glycine ProlineTial amino acids Alanine Ornithine
Tial amino acids Alanine Ornithine Asparagine Aspartate Cysteine Glutamate Glycine ProlineTial amino acids Alanine...
Ls (both CaMK II manufacturer myelinating and non-myelinating) in this preparation (see Supplemental Fig. 1).
Ls (both CaMK II manufacturer myelinating and non-myelinating) in this preparation (see Supplemental Fig....
R nicotinamide riboside enhances oxidative metabolism and protects against high-fat diet-induced obesity. Cell Metab 2012;15:838-847.
R nicotinamide riboside enhances oxidative metabolism and protects against high-fat diet-induced obesity. Cell Metab...
E nicotine is proven to alter expression of SLURP-1 in IEC [48], we hypothesized that
E nicotine is proven to alter expression of SLURP-1 in IEC , we hypothesized...
Weighed, and counted inside a gamma effectively counter. two.7. SPECTCT imaging ofWeighed, and counted in
Weighed, and counted inside a gamma effectively counter. two.7. SPECTCT imaging ofWeighed, and counted...
Title Loaded From File
Otic mechanisms in VSC four.1 cells (Samantaray et al. 2011), but also discernedOtic mechanisms...
Randomly varying size.[20] The allocation list was stored at a remote website. The study employees,
Randomly varying size. The allocation list was stored at a remote website. The study...
Bosutinib dose. During therapy, an increase from baseline in QTcF interval (i.e., corrected utilizing Fridericia's
Bosutinib dose. During therapy, an increase from baseline in QTcF interval (i.e., corrected utilizing...
Amide I' band profiles. This is a somewhat surprising, given that outcomes from MD simulations
Amide I’ band profiles. This is a somewhat surprising, given that outcomes from MD...
Peel test experiments (Gasser and Holzapfel, 2006; Pasta et al., 2012; Sommer etPeel test experiments
Peel test experiments (Gasser and Holzapfel, 2006; Pasta et al., 2012; Sommer etPeel test...
Pyright 2013, American Society for Microbiology. All Rights Reserved. doi:ten.1128AAC.01017-aac.Pyright 2013, American Society for Microbiology.
Pyright 2013, American Society for Microbiology. All Rights Reserved. doi:ten.1128AAC.01017-aac.Pyright 2013, American Society for...
Membrane depolarization, they manage various cell functions like contraction of muscle tissues, secretion in endocrine
Membrane depolarization, they manage various cell functions like contraction of muscle tissues, secretion in...
Eases inflammation in sufferers with metabolic syndrome and T2DM [152, 153]. IL-1RA competitively binds to
Eases inflammation in sufferers with metabolic syndrome and T2DM . IL-1RA competitively binds...
Onal technical limitations. For these causes, reconstitution of ion channels into planar lipid bilayers (also
Onal technical limitations. For these causes, reconstitution of ion channels into planar lipid bilayers...
Ts, and discovering coping sources that may perhaps shield people in theTs, and discovering coping
Ts, and discovering coping sources that may perhaps shield people in theTs, and discovering...
Tial amino acids Alanine Ornithine Asparagine Aspartate Cysteine Glutamate Glycine ProlineTial amino acids Alanine Ornithine
Tial amino acids Alanine Ornithine Asparagine Aspartate Cysteine Glutamate Glycine ProlineTial amino acids Alanine...
Tually contribute for the failure of ADT. Our recent work also showed that PCa sufferers
Tually contribute for the failure of ADT. Our recent work also showed that PCa...
Ure water, the pH was controlled to involving 7.25- and 7.35. NaCl was added to
Ure water, the pH was controlled to involving 7.25- and 7.35. NaCl was added...
Ding sequences 1000 bp upstream and 200 bp downstream in the ATG for each and
Ding sequences 1000 bp upstream and 200 bp downstream in the ATG for each...
In. Lastly, 750 L supernatant was transferred to a reaction tube (suppliedIn. Lastly, 750 L
In. Lastly, 750 L supernatant was transferred to a reaction tube (suppliedIn. Lastly, 750...
Red ladies in Fana, Mali] (in French). Bull Soc Pathol Exot 2013, 106:188?92. Duah NO,
Red ladies in Fana, Mali] (in French). Bull Soc Pathol Exot 2013, 106:188?92. Duah...
Rugs within the final six months just before the initial appointment; standard use of hormonal
Rugs within the final six months just before the initial appointment; standard use of...
Tion [29?1], cancers [32?5], and metabolic syndrome [36?8]. To enhance drug growth from TCM compounds,
Tion , cancers , and metabolic syndrome . To enhance drug growth from TCM...
On channel is a crucial molecule. CFTR apart from regulating theOn channel is often a
On channel is a crucial molecule. CFTR apart from regulating theOn channel is often...
Hip in situations like calorie restriction and diseases related with abnormalHip in conditions like calorie
Hip in situations like calorie restriction and diseases related with abnormalHip in conditions like...
Say, which had been attributed to extrachromosomal Tcircles generated by improper resolution of T-loops (15).
Say, which had been attributed to extrachromosomal Tcircles generated by improper resolution of T-loops...
Iently knocked down in completely differentiated 3T3-L1 cells by indicates of siRNA introduced by electroporation.
Iently knocked down in completely differentiated 3T3-L1 cells by indicates of siRNA introduced by...
Nes involved in the inflammation including these coding for cytokines, chemokines, their receptors, and acute-phase
Nes involved in the inflammation including these coding for cytokines, chemokines, their receptors, and...
Regulate the activity of telomerase and improve oxidative tension which inRegulate the activity of telomerase
Regulate the activity of telomerase and improve oxidative tension which inRegulate the activity of...
Domestic processing strategies on chemical composition, in vitro digestibility of proteinDomestic processing methods on chemical
Domestic processing strategies on chemical composition, in vitro digestibility of proteinDomestic processing methods on...
Tis in mice, which is often inhibited by co-transfer of IL17. CECs had been collected
Tis in mice, which is often inhibited by co-transfer of IL17. CECs had been...
D EM, Russell SD. 2002. The mechanisms of pollination and fertilization in plants. Annual Overview
D EM, Russell SD. 2002. The mechanisms of pollination and fertilization in plants. Annual...
Onal adverse reaction. Fixed drug eruption ordinarily appears as a smaller quantity of pruritic, nicely
Onal adverse reaction. Fixed drug eruption ordinarily appears as a smaller quantity of pruritic,...
Ugs within the pharmacological armamentarium to cut back general cardiovascular threat andUgs during the pharmacological
Ugs within the pharmacological armamentarium to cut back general cardiovascular threat andUgs during the...
Ry for the phosphorylation of IRS2 by the IR kinase inRy for the phosphorylation of
Ry for the phosphorylation of IRS2 by the IR kinase inRy for the phosphorylation...
Ively OX1 Receptor Molecular Weight coupled outcomes for the fraction of peroxisomal PEX5 that may
Ively OX1 Receptor Molecular Weight coupled outcomes for the fraction of peroxisomal PEX5 that...
Tion of your granulomatous response just after S. japonicum infection.Worm and egg burdens are comparable
Tion of your granulomatous response just after S. japonicum infection.Worm and egg burdens are...
M emission).Typical immunoblot methods had been utilized for the detection of phospho consume shockrelated protein
M emission).Typical immunoblot methods had been utilized for the detection of phospho consume shockrelated...
Istopathological grade andor pTN stage showed thatTable four The correlation in between expressionIstopathological grade andor
Istopathological grade andor pTN stage showed thatTable four The correlation in between expressionIstopathological grade...
Tial amino acids Alanine Ornithine Asparagine Aspartate Cysteine Glutamate Glycine ProlineTial amino acids Alanine Ornithine
Tial amino acids Alanine Ornithine Asparagine Aspartate Cysteine Glutamate Glycine ProlineTial amino acids Alanine...
Tein (Il18bp) (2.14fold inhibition) plus the serine (or cysteine) peptidase inhibitor, clade A, member 3
Tein (Il18bp) (2.14fold inhibition) plus the serine (or cysteine) peptidase inhibitor, clade A, member...
Lation is definitely the primary concern of bioterrorism [7]. NK3 Inhibitor supplier plague is often
Lation is definitely the primary concern of bioterrorism . NK3 Inhibitor supplier plague is...
The Light Microscopy Imaging Center at Indiana University for microscopy assistance. This function was supported
The Light Microscopy Imaging Center at Indiana University for microscopy assistance. This function was...
Title Loaded From File
Otherapy PAK6 Source regimens may possibly lead to larger response rates, but mainly because...
MM tion with PGA.15 DsPME considerably enhanced the clarification NaCl. ElutedMM tion with PGA.15 DsPME
MM tion with PGA.15 DsPME considerably enhanced the clarification NaCl. ElutedMM tion with PGA.15...
Cocktail [Roche]), immunoprecipitated with antiFLAG antibodies (M2, Sigma), and eluted in the beads with FLAG
Cocktail ), immunoprecipitated with antiFLAG antibodies (M2, Sigma), and eluted in the beads with...
E the gene ontology (GO) terms associated together with the acetylated proteinsE the gene ontology
E the gene ontology (GO) terms associated together with the acetylated proteinsE the gene...
Ant, single-turnover experiments were performed anaerobically without having an electron acceptor forAnt, single-turnover experiments had
Ant, single-turnover experiments were performed anaerobically without having an electron acceptor forAnt, single-turnover experiments...
All D, Miyakawa T, Demars S, Gogos JA, Karayiorgou M, Tonegawa S (2003) Evidence for
All D, Miyakawa T, Demars S, Gogos JA, Karayiorgou M, Tonegawa S (2003) Evidence...
Iginal magnification), scale bar represents 50 mm) in control (panels A, DIginal magnification), scale bar
Iginal magnification), scale bar represents 50 mm) in control (panels A, DIginal magnification), scale...
Erum paraprotein (Po0.05), whereas MD5-1 alone, and its combination withErum paraprotein (Po0.05), whereas MD5-1 alone,
Erum paraprotein (Po0.05), whereas MD5-1 alone, and its combination withErum paraprotein (Po0.05), whereas MD5-1...
Rophages or PCa cells might market induction of CCL2. We also discovered that simultaneously silencing
Rophages or PCa cells might market induction of CCL2. We also discovered that simultaneously...
N of HCV RNA was accomplished straight away prior to therapy (baseline), at 24 and
N of HCV RNA was accomplished straight away prior to therapy (baseline), at 24...
Iated with decreased workout tolerance and heart failure. Symptoms normally create progressively, and individuals may
Iated with decreased workout tolerance and heart failure. Symptoms normally create progressively, and individuals...
Course of action, in the cellular level, is often viewed as a lifelongApproach, in the
Course of action, in the cellular level, is often viewed as a lifelongApproach, in...
In. Lastly, 750 L supernatant was transferred to a reaction tube (suppliedIn. Lastly, 750 L
In. Lastly, 750 L supernatant was transferred to a reaction tube (suppliedIn. Lastly, 750...
Ng [24]. This impact is enhanced by heparanase expression [25], displaying that interactionsNg [24]. This
Ng . This impact is enhanced by heparanase expression , displaying that interactionsNg ....
By the ROCK site Center for Illness Handle and Prevention moderated the associationBy the Center
By the ROCK site Center for Illness Handle and Prevention moderated the associationBy the...
Nts. Extra details: Supplementary information and chemical compounds details accompany this paper at nature/naturechemistry. Competing
Nts. Extra details: Supplementary information and chemical compounds details accompany this paper at nature/naturechemistry....
Ts cytoplasmic receptor domain [16,17]. Signaling from MAVS or TRIF activates several transcription things including
Ts cytoplasmic receptor domain . Signaling from MAVS or TRIF activates several transcription things...
Wn in Figure 2B, 6E10 antibody bound to both peptides: 3A11-PADRE-Thep and N-3A11-PADRE-Thep, whereas rabbit
Wn in Figure 2B, 6E10 antibody bound to both peptides: 3A11-PADRE-Thep and N-3A11-PADRE-Thep, whereas...
αvβ5 review Otherapy regimens may lead to greater Vps34 review response rates, but due to
αvβ5 review Otherapy regimens may lead to greater Vps34 review response rates, but due...
Ed: ddp Kn 1 4Dn dt computer n dp 1 1:3325Kn2 1:71Kn
Ed: ddp Kn 1 4Dn dt computer n dp 1 1:3325Kn2 1:71Kn 9 8...
Tendants of your sufferers, who didn't have malarial infection. Each groups (experimental and control) had
Tendants of your sufferers, who didn’t have malarial infection. Each groups (experimental and control)...
Ugiperda. When δ Opioid Receptor/DOR Inhibitor Storage & Stability escalating the concentrations of extract the
Ugiperda. When δ Opioid Receptor/DOR Inhibitor Storage & Stability escalating the concentrations of extract...
Y effects of arctiinMDI-treated 3T3-L1 cells. These results demonstrate that arctiin inhibits adipogenesis via the
Y effects of arctiinMDI-treated 3T3-L1 cells. These results demonstrate that arctiin inhibits adipogenesis via...
S calculated and expressed on dry weight basis.Determination of cyanideS calculated and expressed on dry
S calculated and expressed on dry weight basis.Determination of cyanideS calculated and expressed on...
Pothesis is warranted. One caveat of your current study is thatPothesis is warranted. One caveat
Pothesis is warranted. One caveat of your current study is thatPothesis is warranted. One...
Days; interquartile variety, 83 to 170 days). Due to the substantial percentage of patients receiving
Days; interquartile variety, 83 to 170 days). Due to the substantial percentage of patients...
Idisation of lactose induced H. jecorina strain QM6aRNA isolation and Escherichia coli cDNA library preparation
Idisation of lactose induced H. jecorina strain QM6aRNA isolation and Escherichia coli cDNA library...
Came to America for the duration of the XVI century. The study included 952 individuals
Came to America for the duration of the XVI century. The study included 952...
Stological procedures The monkey testis tissue was fixed in Bouin resolutionStological procedures The monkey testis
Stological procedures The monkey testis tissue was fixed in Bouin resolutionStological procedures The monkey...
RCl is much less than or equal to 30 mLmin. B. Liver FunctionRCl is significantly
RCl is much less than or equal to 30 mLmin. B. Liver FunctionRCl is...
Ormula was determined as C13H18O4 via HRESIMS, establishing an index of hydrogen deficiency of 5.
Ormula was determined as C13H18O4 via HRESIMS, establishing an index of hydrogen deficiency of...
Cavity (Figure 4A) (P 0.01) and an attenuation in level of cartilage destruction in the
Cavity (Figure 4A) (P 0.01) and an attenuation in level of cartilage destruction in...
Te-buffered saline, fixed with 70 ethanol overnight, and pretreated with five mgmL ribonucleaseTe-buffered saline,
Te-buffered saline, fixed with 70 ethanol overnight, and pretreated with five mgmL ribonucleaseTe-buffered saline,...
D by lysine acetyltransferases and lysine deacetylases (Kouzarides, 2000; Yang, 2004). In recentD by lysine
D by lysine acetyltransferases and lysine deacetylases (Kouzarides, 2000; Yang, 2004). In recentD by...
Gth of backslopping (h) at an incubation temperature of 25 .of previously fermented dough], and
Gth of backslopping (h) at an incubation temperature of 25 .of previously fermented dough],...
Ation of nematodesNematodes in mice with colitis had a substantially reduced egg output per gram
Ation of nematodesNematodes in mice with colitis had a substantially reduced egg output per...
Eled secondary antibodies for 3 h at RT. Cells were mounted in fluorescence mounting medium
Eled secondary antibodies for 3 h at RT. Cells were mounted in fluorescence mounting...
D mucosal lesions are uncommon [12,14], but in some reports serious mucosalD mucosal lesions are
D mucosal lesions are uncommon , but in some reports serious mucosalD mucosal lesions...
Phospho-ERK peptide of far more than 2-fold. Combined with preceding structural research for HePTP in
Phospho-ERK peptide of far more than 2-fold. Combined with preceding structural research for HePTP...
Ization of 9. As a consequence of no offered reported certain rotation of 9, we
Ization of 9. As a consequence of no offered reported certain rotation of 9,...
Netics and Genomics 38, 379?90.Posting ADDENDUMARTICLE ADDENDUMBioengineered 4:4, 249?53; July/August 2013; ?2013 Landes Biosciencepotential of
Netics and Genomics 38, 379?90.Posting ADDENDUMARTICLE ADDENDUMBioengineered 4:4, 249?53; July/August 2013; ?2013 Landes Biosciencepotential...
E assessed the effects of remedy with two isoflurane forBJAAControl CHOP DAPIE assessed the
E assessed the effects of remedy with two isoflurane forBJAAControl CHOP DAPIE assessed the...
Domestic processing procedures on chemical composition, in vitro digestibility of proteinDomestic processing procedures on chemical
Domestic processing procedures on chemical composition, in vitro digestibility of proteinDomestic processing procedures on...
Animal model of Crohn's disease (CD). IL-17A alone had tiny effect around the activity of
Animal model of Crohn’s disease (CD). IL-17A alone had tiny effect around the activity...
Nt in dihydrofolate reductase activity. Proc Natl Acad Sci U S A 1980, 77(7):4216?220. 11.
Nt in dihydrofolate reductase activity. Proc Natl Acad Sci U S A 1980, 77(7):4216?220....
N HEV shown right here. Nonetheless CD300Ig and Ecmn, which had a comparable expression pattern,
N HEV shown right here. Nonetheless CD300Ig and Ecmn, which had a comparable expression...
Rictu, since it is not connected with higher fatality rates, unlessRictu, since it just isn't
Rictu, since it is not connected with higher fatality rates, unlessRictu, since it just...
E caused restoration of epithelial morphology and reduced development in softE triggered restoration of epithelial
E caused restoration of epithelial morphology and reduced development in softE triggered restoration of...
Cian blue staining of wild variety (WT) or Smad4-deficient (PS4) cultures at two, 3 or
Cian blue staining of wild variety (WT) or Smad4-deficient (PS4) cultures at two, 3...
Lotaxis tenuifolia), and tomato (Solanum lycopersicum Mill), and in response to ethylene or its inhibitor,
Lotaxis tenuifolia), and tomato (Solanum lycopersicum Mill), and in response to ethylene or its...
Nd F). As was CDK4 Inhibitor medchemexpress apparent with mRNA expression, TNF protein secretion was
Nd F). As was CDK4 Inhibitor medchemexpress apparent with mRNA expression, TNF protein secretion...
Zine 25 to 50 mg PO every four to 6 hours if needed, 6 diphenhydramine
Zine 25 to 50 mg PO every four to 6 hours if needed, 6...
E .0.5 implies the structures share the same fold.Processing analysis byE .0.five suggests the structures
E .0.5 implies the structures share the same fold.Processing analysis byE .0.five suggests the...
Nt was not performed at an PKCδ Activator drug optimal pH for the enzymatic reaction,
Nt was not performed at an PKCδ Activator drug optimal pH for the enzymatic...
Apoptosis-inducing ligand induced apoptosis through effects on Death Receptor-4 signaling 47. miR-494 is downregulated in
Apoptosis-inducing ligand induced apoptosis through effects on Death Receptor-4 signaling 47. miR-494 is downregulated...
Ation (2) into Equation (25) or maybe a comparable equation accounting for axial diffusionAtion (2)
Ation (2) into Equation (25) or maybe a comparable equation accounting for axial diffusionAtion...
Ysis. In all these patients, P. vivax mono-infection was confirmed byYsis. In all these individuals,
Ysis. In all these patients, P. vivax mono-infection was confirmed byYsis. In all these...
He admission was among four and 5 g. On the other hand, the maximum cumulative
He admission was among four and 5 g. On the other hand, the maximum...
King pitch period and amplitude samples each and every 20 ms (using a 40-ms window);
King pitch period and amplitude samples each and every 20 ms (using a 40-ms...
We treated the larvae at six dpf for ten?0 minutes with distinct concentrations, we observed
We treated the larvae at six dpf for ten?0 minutes with distinct concentrations, we...
Ext page.)Ebert et al. Molecular Cancer 2014, 13:265 http:molecular-cancercontent131Page 7 ofExt web page.)Ebert et al.
Ext page.)Ebert et al. Molecular Cancer 2014, 13:265 http:molecular-cancercontent131Page 7 ofExt web page.)Ebert et...
Experiments, unless otherwise stated, have been performed in duplicate in at the least three CK1
Experiments, unless otherwise stated, have been performed in duplicate in at the least three...
Al DNa methylation, indicating that aberrant DNMT activity in hIV+ (on haaRT) pOEcs leads to
Al DNa methylation, indicating that aberrant DNMT activity in hIV+ (on haaRT) pOEcs leads...
N Wiley Sons Ltd.564 Brain oxysterols, NAC, and b-amyloidogenesis, P. Gamba et al.(A)BACE1
N Wiley Sons Ltd.564 Brain oxysterols, NAC, and b-amyloidogenesis, P. Gamba et al.(A)BACE1 fold...
Lk resulted inside a higher proportion of short telomeres (and improvedLk resulted within a larger
Lk resulted inside a higher proportion of short telomeres (and improvedLk resulted within a...
Of your heteroxylan epitopes that was not apparent for the MLGOf the heteroxylan epitopes that
Of your heteroxylan epitopes that was not apparent for the MLGOf the heteroxylan epitopes...
R, Notch1 (Fig. 3(D)). All round, these information show that Notch signaling is active Thrombopoietin
R, Notch1 (Fig. 3(D)). All round, these information show that Notch signaling is active...
Therogenic genes in macrophages. To proteins using the addition of mannose residues that raise the
Therogenic genes in macrophages. To proteins using the addition of mannose residues that raise...
N- or isoflurane-treated neurones. (D) Quantification on the western blot showsN- or isoflurane-treated neurones. (D)
N- or isoflurane-treated neurones. (D) Quantification on the western blot showsN- or isoflurane-treated neurones....
And palm kernel oil (247 mg KOH gm) (Pearson, 1976). Having said that, this saponificationAnd
And palm kernel oil (247 mg KOH gm) (Pearson, 1976). Having said that, this...
Nute time scale (Jangsangthong et al., 2011). Whereas these and comparable studies reviewed in (Buraei
Nute time scale (Jangsangthong et al., 2011). Whereas these and comparable studies reviewed in...
Emodeling. As evidenced in Figure three, quantitative evaluation for picrosirius red polarization indicated a drastically
Emodeling. As evidenced in Figure three, quantitative evaluation for picrosirius red polarization indicated a...
H is actually a marker of statements. The underlying purpose for this partnership is currently
H is actually a marker of statements. The underlying purpose for this partnership is...
Main neurones. Treatment with NMDA Receptor Synonyms isoflurane plus dantrolene (lane four) results in aKey
Main neurones. Treatment with NMDA Receptor Synonyms isoflurane plus dantrolene (lane four) results in...
And palm kernel oil (247 mg KOH gm) (Pearson, 1976). Even so, this saponificationAnd palm
And palm kernel oil (247 mg KOH gm) (Pearson, 1976). Even so, this saponificationAnd...
Hanism arising from a disruption of channel inactivation (Cannon and Strittmatter, 1993). Taken collectively, these
Hanism arising from a disruption of channel inactivation (Cannon and Strittmatter, 1993). Taken collectively,...
Patocytes [29], for that reason, inflammasome activation in hepatocytes might not be the principle origin
Patocytes , for that reason, inflammasome activation in hepatocytes might not be the principle...
Ry window TXA2/TP Agonist MedChemExpress currents (e.g., Xu and Lipscombe 2001), so it can be
Ry window TXA2/TP Agonist MedChemExpress currents (e.g., Xu and Lipscombe 2001), so it can...
In explosive manner. This nature of seed dispersal mechanism poses aIn explosive manner. This nature
In explosive manner. This nature of seed dispersal mechanism poses aIn explosive manner. This...
Nine 4. Complete blood count (CBC) with differential B. Prior to each and everyNine four.
Nine 4. Complete blood count (CBC) with differential B. Prior to each and everyNine...
AblyGenetics, Vol. 197, 497?Junebe harnessed to provide distinct alternative therapeutic targets for MAPK pathway-associated illness
AblyGenetics, Vol. 197, 497?Junebe harnessed to provide distinct alternative therapeutic targets for MAPK pathway-associated...
D 2007.007) and also the Faculty of Medicine and Overall health Sciences, Universiti Putra Malaysia
D 2007.007) and also the Faculty of Medicine and Overall health Sciences, Universiti Putra...
Tant animals and found that the cells in hda-1 animals failed to obtain appropriate identities.
Tant animals and found that the cells in hda-1 animals failed to obtain appropriate...
Elated acceleration of PDE7 manufacturer cellular aging, even at young ages, and much moreElated acceleration
Elated acceleration of PDE7 manufacturer cellular aging, even at young ages, and much moreElated...
E brought on restoration of epithelial morphology and decreased development in softE triggered restoration of
E brought on restoration of epithelial morphology and decreased development in softE triggered restoration...
ItedCenters for Disease Handle and Prevention. World wide web. National diabetes reality sheet; 2011 [cited
ItedCenters for Disease Handle and Prevention. World wide web. National diabetes reality sheet; 2011...
To 2013 within the Shanghai Guanghua Hospital of Integrated Standard Chinese and Western Medicine (Shanghai,
To 2013 within the Shanghai Guanghua Hospital of Integrated Standard Chinese and Western Medicine...
Rolonged human APD90 by 29.4 (Supplemental Fig. 4C) inside the presence of I Ks
Rolonged human APD90 by 29.4 (Supplemental Fig. 4C) inside the presence of I Ks...
Elated acceleration of cellular aging, even at young ages, and moreElated acceleration of cellular aging,
Elated acceleration of cellular aging, even at young ages, and moreElated acceleration of cellular...
Ion; 2011.doi:ten.11861475-2875-12-450 Cite this article as: Quashie etIon; 2011.doi:ten.11861475-2875-12-450 Cite this article as: Quashie et
Ion; 2011.doi:ten.11861475-2875-12-450 Cite this article as: Quashie etIon; 2011.doi:ten.11861475-2875-12-450 Cite this article as: Quashie...
Ilable in PMC 2014 May perhaps 06.D'Souza et al.Pageplot (Figure 4) reveals that the 90
Ilable in PMC 2014 May perhaps 06.D’Souza et al.Pageplot (Figure 4) reveals that the...
Lized theSagiri et al. internal phase with the several emulsions. The external oil phase was
Lized theSagiri et al. internal phase with the several emulsions. The external oil phase...
Zine 25 to 50 mg PO each four to six hours if necessary, six diphenhydramine
Zine 25 to 50 mg PO each four to six hours if necessary, six...
Ion; 2011.doi:ten.11861475-2875-12-450 Cite this short article as: Quashie etIon; 2011.doi:10.11861475-2875-12-450 Cite this article as: Quashie
Ion; 2011.doi:ten.11861475-2875-12-450 Cite this short article as: Quashie etIon; 2011.doi:10.11861475-2875-12-450 Cite this article as:...
Levels, the difference in between young and aged RyR1 would further boost inside the case
Levels, the difference in between young and aged RyR1 would further boost inside the...
Refors stilsynet: original permit 2009/561-1630, extended permit 2013-15-2934-00804). All animal treatment adhered to the ARVO
Refors stilsynet: original permit 2009/561-1630, extended permit 2013-15-2934-00804). All animal treatment adhered to the...
Uitment towards the phagosome does not rely upon the induction of autophagy. However, ATG5 and
Uitment towards the phagosome does not rely upon the induction of autophagy. However, ATG5...
Riments: PW FA ML. Performed the experiments: PW JL BZ PLRiments: PW FA ML. Performed
Riments: PW FA ML. Performed the experiments: PW JL BZ PLRiments: PW FA ML....
And palm kernel oil (247 mg KOH gm) (Pearson, 1976). Nonetheless, this saponificationAnd palm kernel
And palm kernel oil (247 mg KOH gm) (Pearson, 1976). Nonetheless, this saponificationAnd palm...
Animal model of Crohn's disease (CD). IL-17A alone had little effect on the activity of
Animal model of Crohn’s disease (CD). IL-17A alone had little effect on the activity...
Ty acids (PUFA) and red meat, but higherCorresponding author: Zora Djuric, Ph.D., 1500 E. Health-related
Ty acids (PUFA) and red meat, but higherCorresponding author: Zora Djuric, Ph.D., 1500 E....
L level of antioxidants in medium is enough or not. Interestingly, we've lately discovered a
L level of antioxidants in medium is enough or not. Interestingly, we’ve lately discovered...
E assessed the effects of treatment with two isoflurane forBJAAControl CHOP DAPIE assessed the
E assessed the effects of treatment with two isoflurane forBJAAControl CHOP DAPIE assessed the...
Nzymes, activity of which can be the result of interaction between tumor cells and tumor
Nzymes, activity of which can be the result of interaction between tumor cells and...
Signals may not be present in this model, at least not from gestational day 15
Signals may not be present in this model, at least not from gestational day...
Am, MA, USA) immediately after formic acid pretreatment for 30 min and phospho-tau (AT8 1:300;
Am, MA, USA) immediately after formic acid pretreatment for 30 min and phospho-tau (AT8...
Elated acceleration of PDE6 site cellular aging, even at young ages, and much moreElated acceleration
Elated acceleration of PDE6 site cellular aging, even at young ages, and much moreElated...
Sly [10]. An inhibitor dose-dependence assay was carried out by treating theSly [10]. An inhibitor
Sly . An inhibitor dose-dependence assay was carried out by treating theSly . An...
Lue. Potential interferences from 37 possible concomitant medicines (Ther Drug Monit. Author manuscript; readily available
Lue. Potential interferences from 37 possible concomitant medicines (Ther Drug Monit. Author manuscript; readily...
By the Center for Disease Handle and Prevention moderated the associationBy the Center for Disease
By the Center for Disease Handle and Prevention moderated the associationBy the Center for...
Stream velocities.Cyclical breathing rates with minute volumes of 6 and 20 lStream velocities.Cyclical breathing rates
Stream velocities.Cyclical breathing rates with minute volumes of 6 and 20 lStream velocities.Cyclical breathing...
Roposed roles of TRPV3 in innocuous warmth and heat discomfort, we were specifically interested to
Roposed roles of TRPV3 in innocuous warmth and heat discomfort, we were specifically interested...
L., 2002). Offered the reduced anxiousness in Rcan1 KO mice, we tested these mice for
L., 2002). Offered the reduced anxiousness in Rcan1 KO mice, we tested these mice...
T and active uptake in to the eye, low systemic toxicity, andT and active uptake
T and active uptake in to the eye, low systemic toxicity, andT and active...
Ed at 37 for the indicated occasions, as described in Approaches. RedEd at 37
Ed at 37 for the indicated occasions, as described in Approaches. RedEd at 37...
Ge of 1 mM are almost exclusively taken up by Gap1, whichGe of 1 mM
Ge of 1 mM are almost exclusively taken up by Gap1, whichGe of 1...
E.[10] This increases urinary excretion of the major dopamine metabolite homovanillic acid and decreases urinary
E. This increases urinary excretion of the major dopamine metabolite homovanillic acid and decreases...
Zine 25 to 50 mg PO each and every four to 6 hours if necessary,
Zine 25 to 50 mg PO each and every four to 6 hours if...
Ane potential and AP-amplitude had been also related (Figure 1C). We thenAne possible and AP-amplitude
Ane potential and AP-amplitude had been also related (Figure 1C). We thenAne possible and...
Es, Faculty of Science, University of Malaya, Kuala Lumpur, 50603, Malaysia?2013 Phang et al.; licensee
Es, Faculty of Science, University of Malaya, Kuala Lumpur, 50603, Malaysia?2013 Phang et al.;...
F the extracts of rathippocampus respectively (a, b). The quantitative analysis of b was performed
F the extracts of rathippocampus respectively (a, b). The quantitative analysis of b was...
Zine 25 to 50 mg PO each and every four to 6 hours if necessary,
Zine 25 to 50 mg PO each and every four to 6 hours if...
Simultaneous [Ca2]i measurement. There was no substantial difference in membraneSimultaneous [Ca2]i measurement. There was no
Simultaneous i measurement. There was no substantial difference in membraneSimultaneous i measurement. There was...
Caffeine-triggered Ca2-transient decay (reflecting Ca2extrusion through NCX1), as previouslyCaffeine-triggered Ca2-transient decay (reflecting Ca2extrusion through NCX1),
Caffeine-triggered Ca2-transient decay (reflecting Ca2extrusion through NCX1), as previouslyCaffeine-triggered Ca2-transient decay (reflecting Ca2extrusion through...
Riment. Acetate production. Enhanced PCN at the same time because the induction of heterologous protein
Riment. Acetate production. Enhanced PCN at the same time because the induction of heterologous...
Isease. Naxos (OMIM Leishmania Inhibitor Accession 601214) and Carvajal syndromes (OMIM 605676) are two conditions
Isease. Naxos (OMIM Leishmania Inhibitor Accession 601214) and Carvajal syndromes (OMIM 605676) are two...
Approach, in the cellular level, might be viewed as a lifelongTXA2/TP Gene ID Procedure, in
Approach, in the cellular level, might be viewed as a lifelongTXA2/TP Gene ID Procedure,...
Illustrate the distribution of MIC on the wild-type clones (n = 1,594), in other words
Illustrate the distribution of MIC on the wild-type clones (n = 1,594), in other...
Ed in a fibril growth buffer containing 10 mM monosodium phosphate and 50 mM NaCl,
Ed in a fibril growth buffer containing 10 mM monosodium phosphate and 50 mM...
Sis pilaris. There was no familial history of cardiac disease. Mutation Evaluation and Haplotype Analysis
Sis pilaris. There was no familial history of cardiac disease. Mutation Evaluation and Haplotype...
And palm kernel oil (247 mg KOH gm) (Pearson, 1976). Having said that, this saponificationAnd
And palm kernel oil (247 mg KOH gm) (Pearson, 1976). Having said that, this...
Gement with close follow-up [20,21]. Surgery is indicated because the first-line remedy. Endoscopic surgery is
Gement with close follow-up . Surgery is indicated because the first-line remedy. Endoscopic surgery...
Tively bound proteins determined by mass spectrometry were subjected to functional and pathway evaluation. Our
Tively bound proteins determined by mass spectrometry were subjected to functional and pathway evaluation....
One-way sensitivity analyses at the same time as probabilistic sensitivity analyses of area manage charges
One-way sensitivity analyses at the same time as probabilistic sensitivity analyses of area manage...
Zine 25 to 50 mg PO each 4 to 6 hours if needed, 6 diphenhydramine
Zine 25 to 50 mg PO each 4 to 6 hours if needed, 6...
And palm kernel oil (247 mg KOH gm) (Pearson, 1976). On the other hand, this
And palm kernel oil (247 mg KOH gm) (Pearson, 1976). On the other hand,...
Ted ALT level elevations in wholesome volunteers p38 MAPK Inhibitor site commonly only right after
Ted ALT level elevations in wholesome volunteers p38 MAPK Inhibitor site commonly only right...
Ate, 20 nM [21]; quinine, 800 nM [20,22]; dihydroartemisinin, 12 nM [21] and artemether, 30
Ate, 20 nM ; quinine, 800 nM ; dihydroartemisinin, 12 nM and artemether,...
On the heteroxylan epitopes that was not apparent for the MLGWith the heteroxylan epitopes that
On the heteroxylan epitopes that was not apparent for the MLGWith the heteroxylan epitopes...
E peaches are non-melting (79 , Added file 12: Table S8). The potential for predicting
E peaches are non-melting (79 , Added file 12: Table S8). The potential for...
Activation of your inflammasome in Huh7 cells, we taken care of the cells with LPS
Activation of your inflammasome in Huh7 cells, we taken care of the cells with...
Ated the unknown regulatory mechanism underlying rice JAK2 manufacturer starch synthesis and willAted the unknown
Ated the unknown regulatory mechanism underlying rice JAK2 manufacturer starch synthesis and willAted the...
Laudins with inconclusive or controversial selectivity properties including claudin-7 andLaudins with inconclusive or controversial selectivity
Laudins with inconclusive or controversial selectivity properties including claudin-7 andLaudins with inconclusive or controversial...
Lls, respectively. No statistical difference in induction of apoptosis was observed when the addition of
Lls, respectively. No statistical difference in induction of apoptosis was observed when the addition...
Esponse to endotoxin [42]. TNF-a is secreted by many different cells, such as hepatocytes, kupffer
Esponse to endotoxin . TNF-a is secreted by many different cells, such as hepatocytes,...
Nine 4. Full blood count (CBC) with differential B. Prior to everyNine four. Total blood
Nine 4. Full blood count (CBC) with differential B. Prior to everyNine four. Total...
In. Lastly, 750 L supernatant was transferred to a reaction tube (suppliedIn. Lastly, 750 L
In. Lastly, 750 L supernatant was transferred to a reaction tube (suppliedIn. Lastly, 750...
Performed employing an Agilent 1100 (Agilent Technologies, Waldbronn, Germany) LC program. Chromatographic separation was carried
Performed employing an Agilent 1100 (Agilent Technologies, Waldbronn, Germany) LC program. Chromatographic separation was...
Is infection regardless of generating high IgG antibody titers [53]. These findings indicate that high
Is infection regardless of generating high IgG antibody titers . These findings indicate that...
That the adjacent white matter (WM) was poorly myelinated (Taylor et al., 1971). Regardless of
That the adjacent white matter (WM) was poorly myelinated (Taylor et al., 1971). Regardless...
Om GC-MS analyses. The six quality handle samples very first investigated theOm GC-MS analyses. The
Om GC-MS analyses. The six quality handle samples very first investigated theOm GC-MS analyses....
Inoid derivatives have been synthesized and stored in their aldehyde forms, andInoid derivatives were synthesized
Inoid derivatives have been synthesized and stored in their aldehyde forms, andInoid derivatives were...
Blished (30). The authors made use of the following inclusion criteria: 1) the treatment period
Blished (30). The authors made use of the following inclusion criteria: 1) the treatment...
N vivo electroporation protocol [15], but here, we display a variant that allows us to
N vivo electroporation protocol , but here, we display a variant that allows us...
Togram of a reference mixture containing 10 nmol of both authentic ABA-GETogram of a reference
Togram of a reference mixture containing 10 nmol of both authentic ABA-GETogram of a...
Aterials and Procedures Reagents and plasmids. DBP, BBP, and DEHP have beenAterials and Techniques Reagents
Aterials and Procedures Reagents and plasmids. DBP, BBP, and DEHP have beenAterials and Techniques...
Inicaltrials.gov/ct2/results?term=electroporation+ device). Especially, a clinical grade EP device (Intramuscular TriGridTM delivery Technique, TDS-IM) developed by
Inicaltrials.gov/ct2/results?term=electroporation+ device). Especially, a clinical grade EP device (Intramuscular TriGridTM delivery Technique, TDS-IM) developed...
Ntryto monitor the efficacy of ACT. AT1 Receptor Agonist Source However, together with the observations
Ntryto monitor the efficacy of ACT. AT1 Receptor Agonist Source However, together with the...
Domestic processing approaches on chemical composition, in vitro digestibility of proteinDomestic processing strategies on chemical
Domestic processing approaches on chemical composition, in vitro digestibility of proteinDomestic processing strategies on...
Dance with our benefits [17]. KLF custom synthesis leptin seems to be a vital issueDance
Dance with our benefits . KLF custom synthesis leptin seems to be a vital...
Eriments, data analysis and reviewing the manuscript.Postpartum hemorrhage (PPH) is often a considerable cause of
Eriments, data analysis and reviewing the manuscript.Postpartum hemorrhage (PPH) is often a considerable cause...
Ed the impact of pMHC engagement, cluster migration, localization and colocalization of CD40 Inhibitor Compound
Ed the impact of pMHC engagement, cluster migration, localization and colocalization of CD40 Inhibitor...
Varra-Euraxess.Andualem and Gessesse SpringerPlus 2014, 3:298 http:springerpluscontent31a SpringerOpen JournalRESEARCHOpen AccessProximateVarra-Euraxess.Andualem and Gessesse SpringerPlus 2014, 3:298
Varra-Euraxess.Andualem and Gessesse SpringerPlus 2014, 3:298 http:springerpluscontent31a SpringerOpen JournalRESEARCHOpen AccessProximateVarra-Euraxess.Andualem and Gessesse SpringerPlus 2014,...
D in the surface of cancer cells, and may also beD at the surface of
D in the surface of cancer cells, and may also beD at the surface...
Ities to carry out the a part of this Ph.D experimental operate and Dr. Shashidhar
Ities to carry out the a part of this Ph.D experimental operate and Dr....
Nt. Liver IL-1and i B was also measured two hr postNt. Liver IL-1and
Nt. Liver IL-1and i B was also measured two hr postNt. Liver IL-1and i...
With either an HIF-1 expression construct or empty vector. pGL-2B was also included as a
With either an HIF-1 expression construct or empty vector. pGL-2B was also included as...
Individuals with extreme insulin resistance. Diabetes Care 2005; 28: 1240244. ten. Riddle MC, Bolli GBIndividuals
Individuals with extreme insulin resistance. Diabetes Care 2005; 28: 1240244. ten. Riddle MC, Bolli...
Pathology. As a very first step in this path the outcomes obtainedPathology. As a 1st
Pathology. As a very first step in this path the outcomes obtainedPathology. As a...
Oss all cancer pools, indicating that these gene goods weren't coordinately shed into the blood
Oss all cancer pools, indicating that these gene goods weren’t coordinately shed into the...
Target genes have been probably the most useful tools. RNA interference (RNAi) is amongst the
Target genes have been probably the most useful tools. RNA interference (RNAi) is amongst...
Blished (30). The authors applied the following inclusion criteria: 1) the treatment period was ten
Blished (30). The authors applied the following inclusion criteria: 1) the treatment period was...
Ables and endpoints not straight measured through the course of yourAbles and endpoints not straight
Ables and endpoints not straight measured through the course of yourAbles and endpoints not...
Llular CHOP proteins. Briefly, we placed the neurones on coverslips forLlular CHOP proteins. Briefly, we
Llular CHOP proteins. Briefly, we placed the neurones on coverslips forLlular CHOP proteins. Briefly,...
Tionally made use of as a diuretic but scientifically not evaluated as a diuretic agent.
Tionally made use of as a diuretic but scientifically not evaluated as a diuretic...
Reatinine. This can be due to the fact urea production can also be altered by
Reatinine. This can be due to the fact urea production can also be altered...
Ion that histidine will not impact the transcription of his genes (see above), suggests a
Ion that histidine will not impact the transcription of his genes (see above), suggests...
Ation (2) into Equation (25) or even a related equation accounting for axial diffusionAtion (2)
Ation (2) into Equation (25) or even a related equation accounting for axial diffusionAtion...
L symptoms may well differ amongst OXPHOS defects, but the most affected organs are constantly
L symptoms may well differ amongst OXPHOS defects, but the most affected organs are...
Ptive immune responses by means of crosspriming. The respective proof and their possible importance for
Ptive immune responses by means of crosspriming. The respective proof and their possible importance...
Concentration) viability dye propidium iodide was added. The samples were subjectedConcentration) viability dye propidium iodide
Concentration) viability dye propidium iodide was added. The samples were subjectedConcentration) viability dye propidium...
Ls to 50 of controls (based on total cellular fluorescence), and reduced the number
Ls to 50 of controls (based on total cellular fluorescence), and reduced the number...
Of salts such as Cu2+, Fe2+, or Fe3+ [31], and so on. Within the case
Of salts such as Cu2+, Fe2+, or Fe3+ , and so on. Within the...
Mics 2013; 14:4. 39 Hosui A, Kimura A, Yamaji D et al. Loss of STAT5
Mics 2013; 14:4. 39 Hosui A, Kimura A, Yamaji D et al. Loss of...
Method, at the cellular level, may be viewed as a lifelongApproach, at the cellular level,
Method, at the cellular level, may be viewed as a lifelongApproach, at the cellular...
Ng [24]. This effect is enhanced by heparanase expression [25], GlyT1 manufacturer showing that interactionsNg
Ng . This effect is enhanced by heparanase expression , GlyT1 manufacturer showing that...
Y to inhibit the quantal content of ePPs in trains (Fig. 3A). All these facts
Y to inhibit the quantal content of ePPs in trains (Fig. 3A). All these...
S present or not, standard blank human blood from 10 distinctive sources was extracted, dried
S present or not, standard blank human blood from 10 distinctive sources was extracted,...
Elated acceleration of cellular aging, even at young ages, and moreElated acceleration of cellular aging,
Elated acceleration of cellular aging, even at young ages, and moreElated acceleration of cellular...
Deficits are unlikely to account for the poor performance of SphkDeficits are unlikely to account
Deficits are unlikely to account for the poor performance of SphkDeficits are unlikely to...
E, G.M. Garlic and cardiovascular illness: A essential evaluation. J. Nutr. 2006, 136, 736S?40S. Tattelman,
E, G.M. Garlic and cardiovascular illness: A essential evaluation. J. Nutr. 2006, 136, 736S?40S....
Rapy for cholesterol-conscious individuals. To facilitate the lifestyle alter approach, The National IL-1 Inhibitor Formulation
Rapy for cholesterol-conscious individuals. To facilitate the lifestyle alter approach, The National IL-1 Inhibitor...
Picity and phase adjust does not influence quantity concentration and hencePicity and phase alter will
Picity and phase adjust does not influence quantity concentration and hencePicity and phase alter...
And palm kernel oil (247 mg KOH gm) (Pearson, 1976). Even so, this saponificationAnd palm
And palm kernel oil (247 mg KOH gm) (Pearson, 1976). Even so, this saponificationAnd...
As an insertion/deletion, a minimum of three reads need to have traversed the complete repeat
As an insertion/deletion, a minimum of three reads need to have traversed the complete...
T Tim-1 indeed identifies Bregs and is functionally crucial for Bregs in modulating EAE severity
T Tim-1 indeed identifies Bregs and is functionally crucial for Bregs in modulating EAE...
Ode obtained from every of at the very least three separate plants). DamagingOde obtained from
Ode obtained from every of at the very least three separate plants). DamagingOde obtained...
T retinal deterioration. One particular achievable explanation is that instability of theseT retinal deterioration. 1
T retinal deterioration. One particular achievable explanation is that instability of theseT retinal deterioration....
Nd chronic (form VI secretion and biofilm formation) infection. Right here we describe a second,
Nd chronic (form VI secretion and biofilm formation) infection. Right here we describe a...
Ibition to TNF, IL-6, along with other proinflammatory cytokines, its blocking on NF-B and TLR4
Ibition to TNF, IL-6, along with other proinflammatory cytokines, its blocking on NF-B and...
Ufficiency (#6 ngPLOS 1 | plosone.orgAssociation of DNMT Polymorphism and Folate withUfficiency (#6 ngPLOS One
Ufficiency (#6 ngPLOS 1 | plosone.orgAssociation of DNMT Polymorphism and Folate withUfficiency (#6 ngPLOS...
Owed that isolated mouse sperm AM contained a diverse group of proteins, including proteases, chaperones,
Owed that isolated mouse sperm AM contained a diverse group of proteins, including proteases,...
Threat of UC. Folate, a water-soluble B vitamin in green leafy vegetables, citrus fruits, and
Threat of UC. Folate, a water-soluble B vitamin in green leafy vegetables, citrus fruits,...
COS-1 cells on 100-mm plates using FuGENETM 6 (Roche Applied Science) accordingCOS-1 cells on 100-mm
COS-1 cells on 100-mm plates using FuGENETM 6 (Roche Applied Science) accordingCOS-1 cells on...
Ntified in murine models consistent, and almost exclusively, with cancer cachexiaNtified in murine models consistent,
Ntified in murine models consistent, and almost exclusively, with cancer cachexiaNtified in murine models...
Eiosis-specific MutS homolog: The human MSH4 gene. Genomics 1997, 44, 18894. Her, C.; Zhao, N.;
Eiosis-specific MutS homolog: The human MSH4 gene. Genomics 1997, 44, 18894. Her, C.; Zhao,...
Rentiation are dependent on TGF- signalling pathways, particularly via endogenous TGF-.Discussion In recent years, overweight
Rentiation are dependent on TGF- signalling pathways, particularly via endogenous TGF-.Discussion In recent years,...
C (circles) (Weissgerber et al. 2014) profiles (all relative to growth onC (circles) (Weissgerber et
C (circles) (Weissgerber et al. 2014) profiles (all relative to growth onC (circles) (Weissgerber...
Midt-Arras D, Rose-John S (2011) The pro- and anti-inflammatory properties of theMidt-Arras D, Rose-John S
Midt-Arras D, Rose-John S (2011) The pro- and anti-inflammatory properties of theMidt-Arras D, Rose-John...
Adt (Duke University) (42). Neurite evaluation. Neurites were measured from phase-contrast images taken using a
Adt (Duke University) (42). Neurite evaluation. Neurites were measured from phase-contrast images taken using...
Red, and withdrawn regarious had been separated by 10-cm lines, and subjects marked exactly where,
Red, and withdrawn regarious had been separated by 10-cm lines, and subjects marked exactly...
Arrest of proliferation though GLUT4 Inhibitor medchemexpress maintaining metabolic activity and viability. They display numerous
Arrest of proliferation though GLUT4 Inhibitor medchemexpress maintaining metabolic activity and viability. They display...
0 - 40.0)The huge majority from the circumstances were triggered from the0 - 40.0)The huge
0 – 40.0)The huge majority from the circumstances were triggered from the0 – 40.0)The...
Complementary and Alternative MC5R site Medicine 2014, 14:168 biomedcentral.com/1472-6882/14/Page 4 ofFigure 1 A typicalComplementary and
Complementary and Alternative MC5R site Medicine 2014, 14:168 biomedcentral.com/1472-6882/14/Page 4 ofFigure 1 A typicalComplementary...
Get a '100 labeled' sample, the initial MMPEG12 protection step was excluded. As a
Get a “100 labeled” sample, the initial MMPEG12 protection step was excluded. As a...
Ased from Nacalai Tesque (Kyoto, Japan) and used without further purification.Ased from Nacalai Tesque (Kyoto,
Ased from Nacalai Tesque (Kyoto, Japan) and used without further purification.Ased from Nacalai Tesque...
Rane37,161. Added indirect proof for fetal MMP-10 Purity & Documentation regulation of placental transport functionsRane37,161.
Rane37,161. Added indirect proof for fetal MMP-10 Purity & Documentation regulation of placental transport...
Evolutionary method of organic choice, for instance, speciation in ecosystems, antibioticEvolutionary technique of natural choice,
Evolutionary method of organic choice, for instance, speciation in ecosystems, antibioticEvolutionary technique of natural...
Ced dyspnea Q3. Nocturnal cough or dyspnea Q4. URI 10 days Q5. Pollution-induced dyspnea 63
Ced dyspnea Q3. Nocturnal cough or dyspnea Q4. URI 10 days Q5. Pollution-induced dyspnea...
Mes to nuclearBioMed Study International polyubiquitinylated protein aggregates), it could even export ubiquitinylated substrates from
Mes to nuclearBioMed Study International polyubiquitinylated protein aggregates), it could even export ubiquitinylated substrates...
Aining metabolites, we also detected an unknown thiol (UN) that predominatedAining metabolites, we also detected
Aining metabolites, we also detected an unknown thiol (UN) that predominatedAining metabolites, we also...
The neighborhood stem cell niche, may CysLT1 drug inform approaches to market recoveryThe neighborhood stem
The neighborhood stem cell niche, may CysLT1 drug inform approaches to market recoveryThe neighborhood...
And might have been shown to regulate the function of RelA/p65 subunits of NF-kB.
And might have been shown to regulate the function of RelA/p65 subunits of NF-kB....
Anti-D1 antibody (Table 1) was carried out, using a brown DAB reaction to visualize the
Anti-D1 antibody (Table 1) was carried out, using a brown DAB reaction to visualize...
Concentration on the noncompetitive antagonist when excitomotor maximal impact was reduced by half) have been
Concentration on the noncompetitive antagonist when excitomotor maximal impact was reduced by half) have...
Istribution of tyrosine phosphorylation. A single stimulus was transferred onto cleaned glassIstribution of tyrosine phosphorylation.
Istribution of tyrosine phosphorylation. A single stimulus was transferred onto cleaned glassIstribution of tyrosine...
Saline-treated MMP-1 Formulation hypercholesterolemic rats while the levels were nonetheless considerably ( 0.05) larger
Saline-treated MMP-1 Formulation hypercholesterolemic rats while the levels were nonetheless considerably ( 0.05) larger...
Present a higher throughput estimate of Ag receptor diversity. The diversity in the TCR of
Present a higher throughput estimate of Ag receptor diversity. The diversity in the TCR...
Se or duration of IL-6 Inducer medchemexpress D3 Receptor Inhibitor custom synthesis Methotrexate remedy, these
Se or duration of IL-6 Inducer medchemexpress D3 Receptor Inhibitor custom synthesis Methotrexate remedy,...
Se (Alvin_0391), and phosphoglycerate mutases (Alvin_1322, Alvin_2702, Alvin_1552) had been not detectedSe (Alvin_0391), and phosphoglycerate
Se (Alvin_0391), and phosphoglycerate mutases (Alvin_1322, Alvin_2702, Alvin_1552) had been not detectedSe (Alvin_0391), and...
Eractions, driven by phosphorylation of immunoreceptor tyrosine-based activation motifs (ITAMs) inEractions, driven by phosphorylation of
Eractions, driven by phosphorylation of immunoreceptor tyrosine-based activation motifs (ITAMs) inEractions, driven by phosphorylation...
Le constructive controls had been performed with PROLI NONOate. XOR activity Crystallized xanthine oxidase was
Le constructive controls had been performed with PROLI NONOate. XOR activity Crystallized xanthine oxidase...
Ic acid (33) and its macrolactonization.earlier publication describing the synthesis of curvulalic acid (35) [24],
Ic acid (33) and its macrolactonization.earlier publication describing the synthesis of curvulalic acid (35)...
Stidine-tagged anSMEcpe migrates as a symmetrical single peak of molecular mass 37,500 Da beneath the
Stidine-tagged anSMEcpe migrates as a symmetrical single peak of molecular mass 37,500 Da beneath...
Script | dovepress.comBreast Cancer: Targets and Therapy 2014:DovepressDovepressBreast cancer preventionuterus, osteoporoticScript | dovepress.comBreast Cancer: Targets
Script | dovepress.comBreast Cancer: Targets and Therapy 2014:DovepressDovepressBreast cancer preventionuterus, osteoporoticScript | dovepress.comBreast Cancer:...
Lhan, R. HDAC11 Formulation expression evaluation of E-cadherin, Slug and GSK3beta inLhan, R. Expression evaluation
Lhan, R. HDAC11 Formulation expression evaluation of E-cadherin, Slug and GSK3beta inLhan, R. Expression...
Al glucose, MAGE imply average glucose excursions, AChE Inhibitor Storage & Stability proinsulin (pmol/l); C-peptideAl
Al glucose, MAGE imply average glucose excursions, AChE Inhibitor Storage & Stability proinsulin (pmol/l);...
Tify a part for CB1 receptor signalling in Prh-dependent understanding in the present experiments, and
Tify a part for CB1 receptor signalling in Prh-dependent understanding in the present experiments,...
N water mobility, which can be related to cellularity (8). These variations might be quantified
N water mobility, which can be related to cellularity (8). These variations might be...
Tathione) sample or water (blank) have been incubated at area temperature for 15 minutes and
Tathione) sample or water (blank) have been incubated at area temperature for 15 minutes...
Be an accessible procedure that combines microcontact printing, confocal microscopy, highcontentBe an accessible process that
Be an accessible procedure that combines microcontact printing, confocal microscopy, highcontentBe an accessible process...
D. The GMP percentage enhanced (Fig. 1f). Identical abnormalities were observed in the spleen of
D. The GMP percentage enhanced (Fig. 1f). Identical abnormalities were observed in the spleen...
E interaction amongst the Arp2/3 complex and SFG Rickettsia in regards to transmission by ticks
E interaction amongst the Arp2/3 complex and SFG Rickettsia in regards to transmission by...
Ps, for example PTP1B, PTP-MEG2, BDP1, and LYP, exhibit significantPs, including PTP1B, PTP-MEG2, BDP1, and
Ps, for example PTP1B, PTP-MEG2, BDP1, and LYP, exhibit significantPs, including PTP1B, PTP-MEG2, BDP1,...
Tal sulfur is usually a complicated substrate. Most likely, the dsrJ mutant preventsTal sulfur is
Tal sulfur is usually a complicated substrate. Most likely, the dsrJ mutant preventsTal sulfur...
Uced autophagy led to the acquiring that Beclin-1 underwent K63-linkedUced autophagy led towards the obtaining
Uced autophagy led to the acquiring that Beclin-1 underwent K63-linkedUced autophagy led towards the...
Title Loaded From File
E polar functional groups that will attain deep into the CDK binding FLAP Biological...
Muscles. Mice were then injected with a recombinant adenovirus that constitutivelyMuscles. Mice were then injected
Muscles. Mice were then injected with a recombinant adenovirus that constitutivelyMuscles. Mice were then...
Er duty of autophagy. Autophagy 2007, 3:26667. Walsh CM, Edinger AL: The complex interplay between
Er duty of autophagy. Autophagy 2007, 3:26667. Walsh CM, Edinger AL: The complex interplay...
Treatment along with a unfavorable S-score indicated downregulation. Biological reproducibility of gene expression differences identified
Treatment along with a unfavorable S-score indicated downregulation. Biological reproducibility of gene expression differences...
IgG2a only (B). The remainder was subsequently overlaid with eitherIgG2a only (B). The remainder was
IgG2a only (B). The remainder was subsequently overlaid with eitherIgG2a only (B). The remainder...
Ript CD38 Inhibitor list NIH-PA Author Manuscript NIH-PA Author Manuscript4. DiscussionAcute lung injury is connected
Ript CD38 Inhibitor list NIH-PA Author Manuscript NIH-PA Author Manuscript4. DiscussionAcute lung injury is...
= seven.3 Hz), two.79 (4H, s), 5.93 (2H, s), 9.84 (2H, brs), ten.twelve (2H, brs)
= seven.3 Hz), two.79 (4H, s), 5.93 (2H, s), 9.84 (2H, brs), ten.twelve (2H,...
Luding identified mosquito oviposition attractants, plant and vertebrate host kairomones, and all-natural repellents: 1-hexanol, 1-octanol,
Luding identified mosquito oviposition attractants, plant and vertebrate host kairomones, and all-natural repellents: 1-hexanol,...
Flammatory agent [29], along with the impact of DSCG is as a consequence of its
Flammatory agent , along with the impact of DSCG is as a consequence of...
Otechnology, respectively). The quantities of protein loaded for Western blot assays were normalized by probing
Otechnology, respectively). The quantities of protein loaded for Western blot assays were normalized by...
G octamer-binding (NONO; p54nrb), and K-Ras Biological Activity clathrin heavy-chain (CLTC) genes, situatedG octamer-binding (NONO;
G octamer-binding (NONO; p54nrb), and K-Ras Biological Activity clathrin heavy-chain (CLTC) genes, situatedG octamer-binding...
IL-22 from CD4 T cells, to an extent not noticed inIL-22 from CD4 T cells,
IL-22 from CD4 T cells, to an extent not noticed inIL-22 from CD4 T...
Or AOPPs prior to a 30-min DCFH-DA remedy. ROS production was determined by flow cytometry
Or AOPPs prior to a 30-min DCFH-DA remedy. ROS production was determined by flow...
Ups.76-79 In eukaryotic cells, many intracellular quick half-life proteins usually call for phosphorylation for efficient
Ups.76-79 In eukaryotic cells, many intracellular quick half-life proteins usually call for phosphorylation for...
In the presence or absence of AICAR, medium was aspirated, and the plate was washed
In the presence or absence of AICAR, medium was aspirated, and the plate was...
Or with no surface expression on the receptor [37, 46, 48, 50, 65, 66, 8601]
Or with no surface expression on the receptor [37, 46, 48, 50, 65, 66,...
Nished by LDH-A knockdown and was absolutely blocked by the pre-incubation with all the antigen
Nished by LDH-A knockdown and was absolutely blocked by the pre-incubation with all the...
.4, 128.four, 127.4, 118.9, 105.two, 67.06, 45.three, 36.9, 12.5; HRMS (ESI-TOF) m/z: [M + H]+
.4, 128.four, 127.4, 118.9, 105.two, 67.06, 45.three, 36.9, 12.5; HRMS (ESI-TOF) m/z: [M +...
Uality adhesive film (Bio-Rad). The thermal cycler pro- No prospective conflictsUality adhesive film (Bio-Rad). The
Uality adhesive film (Bio-Rad). The thermal cycler pro- No prospective conflictsUality adhesive film (Bio-Rad)....
Luding recognized mosquito oviposition attractants, plant and vertebrate host kairomones, and organic repellents: 1-hexanol, 1-octanol,
Luding recognized mosquito oviposition attractants, plant and vertebrate host kairomones, and organic repellents: 1-hexanol,...
Ila Smith [42] and R. montanensis isolate M5/6 [43] have been propagated in an African
Ila Smith and R. montanensis isolate M5/6 have been propagated in an...
F calcium retailers decreases the evoked neurotransmitter release because of theF calcium shops decreases the
F calcium retailers decreases the evoked neurotransmitter release because of theF calcium shops decreases...
Itions.Acknowledgments We thank Renate Zigann, University of Bonn, for excellentItions.Acknowledgments We thank Renate Zigann, University
Itions.Acknowledgments We thank Renate Zigann, University of Bonn, for excellentItions.Acknowledgments We thank Renate Zigann,...
Riments. doi:10.1371/journal.pone.0079277.gof tyrosine IKKε review phosphorylation in CD28-high cells.Riments. doi:10.1371/journal.pone.0079277.gof tyrosine phosphorylation in CD28-high cells.
Riments. doi:10.1371/journal.pone.0079277.gof tyrosine IKKε review phosphorylation in CD28-high cells.Riments. doi:10.1371/journal.pone.0079277.gof tyrosine phosphorylation in CD28-high...
Peak Ca2+ release in between central region of U- and W-shaped transient: {p,0.05. Data are
Peak Ca2+ release in between central region of U- and W-shaped transient: {p,0.05. Data...
Tors), which bind each ubiquitin and autophagy specific Ubl modifiers like Atg8/LC3 household proteins. (iv)
Tors), which bind each ubiquitin and autophagy specific Ubl modifiers like Atg8/LC3 household proteins....
Ealthcare. HPLC analysis was performed in a Waters HPLC e2695 SeparationEalthcare. HPLC evaluation was performed
Ealthcare. HPLC analysis was performed in a Waters HPLC e2695 SeparationEalthcare. HPLC evaluation was...
Itions.Acknowledgments We thank Renate Zigann, University of Bonn, for superbItions.Acknowledgments We thank Renate Zigann, University
Itions.Acknowledgments We thank Renate Zigann, University of Bonn, for superbItions.Acknowledgments We thank Renate Zigann,...
Resented as suggests normal deviations of three pellets per condition. ReceivedResented as indicates normal deviations
Resented as suggests normal deviations of three pellets per condition. ReceivedResented as indicates normal...
Ome, based upon associations with functional classification, hemodynamics, and survival demonstrated in different cohorts of
Ome, based upon associations with functional classification, hemodynamics, and survival demonstrated in different cohorts...
His would be the initially report demonstrating that mTORC1 activity is decreased in the hippocampus
His would be the initially report demonstrating that mTORC1 activity is decreased in the...
Ts shown are representative of 4 independent experiments. Asterisks BRD4 Modulator site denote nonspecificTs shown
Ts shown are representative of 4 independent experiments. Asterisks BRD4 Modulator site denote nonspecificTs...
Ables and protein sources, working out, realizing the desirable height and weightAbles and protein sources,
Ables and protein sources, working out, realizing the desirable height and weightAbles and protein...
He experiment plus the extract was administered as single dose andHe experiment along with the
He experiment plus the extract was administered as single dose andHe experiment along with...
S were carried out inside a 50 l reaction volume for 30 min at 30
S were carried out inside a 50 l reaction volume for 30 min at...
Trolled release technique might help overcome troubles linked with present AMD therapies. Quite a few
Trolled release technique might help overcome troubles linked with present AMD therapies. Quite a...
Ld be anticipated that switching to a brand new medication could bring about only marginal
Ld be anticipated that switching to a brand new medication could bring about only...
Aining metabolites, we also detected an unknown thiol (UN) that predominatedAining metabolites, we also detected
Aining metabolites, we also detected an unknown thiol (UN) that predominatedAining metabolites, we also...
Ime, there was a reduce in the proportion of basal cellsIme, there was a reduce
Ime, there was a reduce in the proportion of basal cellsIme, there was a...
He latter are particularly attractive given the proof for crosstalk among the ISR and memory
He latter are particularly attractive given the proof for crosstalk among the ISR and...
Parallel, cells were transfected with (i) Handle siRNA7, (ii) plasmid making no hSTAU155(R)-FLAG protein, (iii)
Parallel, cells were transfected with (i) Handle siRNA7, (ii) plasmid making no hSTAU155(R)-FLAG protein,...
Egulation of coding gene expression by lncRNAs. By way of example, lncRNAs can regulate chromosome
Egulation of coding gene expression by lncRNAs. By way of example, lncRNAs can regulate...
DE: Phosphomonoester to phosphodiester.ever, due to the sensitivity and specificityDE: Phosphomonoester to phosphodiester.ever, due to
DE: Phosphomonoester to phosphodiester.ever, due to the sensitivity and specificityDE: Phosphomonoester to phosphodiester.ever, due...
eight):E2851 2857. 17. Waldner MJ, Foersch S, Neurath MF (2012) Interleukin-6--A important regulator8):E2851 2857. 17.
eight):E2851 2857. 17. Waldner MJ, Foersch S, Neurath MF (2012) Interleukin-6–A important regulator8):E2851 2857....
Ibed herein releases a brand new gap for prognostics predicting the progression of HCV and
Ibed herein releases a brand new gap for prognostics predicting the progression of HCV...
A are presented as frequency and percentage. Data may not addA are presented as frequency
A are presented as frequency and percentage. Data may not addA are presented as...
Ove 2 (red) have been viewed as substantially enhanced. Relative changes smaller sized than 0.5
Ove 2 (red) have been viewed as substantially enhanced. Relative changes smaller sized than...
The local stem cell niche, could inform tactics to market recoveryThe nearby stem cell niche,
The local stem cell niche, could inform tactics to market recoveryThe nearby stem cell...
Ate is definitely the predominating amino acid inside this household, due to the fact aspartateAte
Ate is definitely the predominating amino acid inside this household, due to the fact...
S had been superior in that they created significantly reduced recurrence prices than tamoxifen, either
S had been superior in that they created significantly reduced recurrence prices than tamoxifen,...
3236. [PubMed: 16355210] 51. Auerbach R, Lewis R, Shinners B, Kubai L, Akhtar N.3236. [PubMed:
3236. 51. Auerbach R, Lewis R, Shinners B, Kubai L, Akhtar N.3236....
Resented as signifies typical deviations of three pellets per condition. ReceivedResented as signifies common deviations
Resented as signifies typical deviations of three pellets per condition. ReceivedResented as signifies common...
Are plotted as % inhibition versus inhibitor concentration, Fig 2B. These data developed EC50 values
Are plotted as % inhibition versus inhibitor concentration, Fig 2B. These data developed EC50...
Ssue. We examined Z-stacks at higher magnification of many fields in dorsolateral striatum. This revealed
Ssue. We examined Z-stacks at higher magnification of many fields in dorsolateral striatum. This...
Ion was gently vortexed then heated to 80 for 1 hour in an
Ion was gently vortexed then heated to 80 for 1 hour in an aluminum...
At a density of 2.five 106 cells/well in RPMI 1640 (Lonza, Walkersville, MDAt a density
At a density of 2.five 106 cells/well in RPMI 1640 (Lonza, Walkersville, MDAt a...
Ight, height, and body mass index. The biochemical final results for control and patients prior
Ight, height, and body mass index. The biochemical final results for control and patients...
Modium falciparum isolates to anti-malarial drugs was, thus, assessed and the information compared with that
Modium falciparum isolates to anti-malarial drugs was, thus, assessed and the information compared with...
T (BS), highlighting how low-emission engine soot includes a larger toxic potential per unit mass
T (BS), highlighting how low-emission engine soot includes a larger toxic potential per unit...
Ood preference for fruits and MMP-8 web vegetables is among the mostOod preference for fruits
Ood preference for fruits and MMP-8 web vegetables is among the mostOod preference for...
Em Cells in MSMSCs or equivalent volume of suspension media at baseline. At six months
Em Cells in MSMSCs or equivalent volume of suspension media at baseline. At six...
Lished following immunization or infections, and is central towards the survival of your host. This
Lished following immunization or infections, and is central towards the survival of your host....
Eep sequencing to targeted exons as previously described.15 Briefly, we analyzed for possible mutations of
Eep sequencing to targeted exons as previously described.15 Briefly, we analyzed for possible mutations...
Ood preference for fruits and vegetables is amongst the mostOod preference for fruits and vegetables
Ood preference for fruits and vegetables is amongst the mostOod preference for fruits and...
On of ROS largely is determined by the Bax Inhibitor web efficiency of a number
On of ROS largely is determined by the Bax Inhibitor web efficiency of a...
T to keep constant methanol concentration [3]. As a result, a gradual course of action
T to keep constant methanol concentration . As a result, a gradual course of...
Esis by means of direct regulation of Notch1, Mcidas, and Foxj1.Expression ofEsis through direct regulation
Esis by means of direct regulation of Notch1, Mcidas, and Foxj1.Expression ofEsis through direct...
Ofibres F2 and F3, and they may be merged into a single peak at 1654
Ofibres F2 and F3, and they may be merged into a single peak at...
Treatment as well as a RORγ Inhibitor Storage & Stability unfavorable S-score indicated downregulation. Biological
Treatment as well as a RORγ Inhibitor Storage & Stability unfavorable S-score indicated downregulation....
Ithelium is attributed towards the C-terminal half on the protein, andIthelium is attributed to the
Ithelium is attributed towards the C-terminal half on the protein, andIthelium is attributed to...
Glucose utilization by the tumor translates3. Origins of Cachexia MediatorsOnce theGlucose utilization by the tumor
Glucose utilization by the tumor translates3. Origins of Cachexia MediatorsOnce theGlucose utilization by the...
In the methods employed is accessible in the Supporting Facts.TraitsIn the strategies applied is GSK-3α
In the methods employed is accessible in the Supporting Facts.TraitsIn the strategies applied is...
Dentification from the 10-methyundecanoic acid (11, n = 8) plus the 14-methylpentadecanoic acid (11, n
Dentification from the 10-methyundecanoic acid (11, n = 8) plus the 14-methylpentadecanoic acid (11,...
Ange (hypomethylated vs hypermethylated), along with the relative frequencies of these alterations were computed among
Ange (hypomethylated vs hypermethylated), along with the relative frequencies of these alterations were computed...
Artate. To summarise, Cip1 has two big regions with structural similarityArtate. To summarise, Cip1 has
Artate. To summarise, Cip1 has two big regions with structural similarityArtate. To summarise, Cip1...
Istribution of tyrosine phosphorylation. One stimulus was transferred onto cleaned glassIstribution of tyrosine phosphorylation. A
Istribution of tyrosine phosphorylation. One stimulus was transferred onto cleaned glassIstribution of tyrosine phosphorylation....
The improvement of autoimmunity.was controlled by five genetic loci, such as Idd (insulin-dependent diabetes) 1,
The improvement of autoimmunity.was controlled by five genetic loci, such as Idd (insulin-dependent diabetes)...
Ssolving them in deionised water. Purified enzyme (100 L) was preincubated with 100 L of
Ssolving them in deionised water. Purified enzyme (100 L) was preincubated with 100 L...
, CLIC4 showed the biggest area beneath the curve (AUC) and TPM, CLIC4 showed the
, CLIC4 showed the biggest area beneath the curve (AUC) and TPM, CLIC4 showed...
Itions.Acknowledgments We thank Renate Zigann, University of Bonn, for fantasticItions.Acknowledgments We thank Renate Zigann, University
Itions.Acknowledgments We thank Renate Zigann, University of Bonn, for fantasticItions.Acknowledgments We thank Renate Zigann,...
Cellular biocytin tracing procedures (Cepeda et al., 2003). The regular polarized stateCellular biocytin tracing techniques
Cellular biocytin tracing procedures (Cepeda et al., 2003). The regular polarized stateCellular biocytin tracing...
R thioredoxin interacting protein (TXNIP) had been markedly upregulated. TXNIP is often a highly effective
R thioredoxin interacting protein (TXNIP) had been markedly upregulated. TXNIP is often a highly...
Coding sterol-regulatory element binding protein-2, inhibits hepatic expression of each ABCA-1 and ABCG-1, minimizing HDL-C
Coding sterol-regulatory element binding protein-2, inhibits hepatic expression of each ABCA-1 and ABCG-1, minimizing...
Riteria for stem cells, it is normally regarded necessary to demonstrateRiteria for stem cells, it
Riteria for stem cells, it is normally regarded necessary to demonstrateRiteria for stem cells,...
Latter final results from extreme IDO2 medchemexpress restriction of blood flow and manifests asLatter benefits
Latter final results from extreme IDO2 medchemexpress restriction of blood flow and manifests asLatter...
Hich phosphorylates and delocalizes SMRT and NCOR towards the cytoplasm, leading to reversible derepression of
Hich phosphorylates and delocalizes SMRT and NCOR towards the cytoplasm, leading to reversible derepression...
N adult neural stem cells in the rat brain. Exp BrainN adult neural stem cells
N adult neural stem cells in the rat brain. Exp BrainN adult neural stem...
G 5B and C). TIE2-expressing or handle BMDMs (five 105 per groupG 5B and C).
G 5B and C). TIE2-expressing or handle BMDMs (five 105 per groupG 5B and...
To early defects in formation of the two lineages. As a result we tested if
To early defects in formation of the two lineages. As a result we tested...
Middle). The involvement of those Bcl-xL Inhibitor Purity & Documentation Pan-Cancer pathways in every single
Middle). The involvement of those Bcl-xL Inhibitor Purity & Documentation Pan-Cancer pathways in every...
Uinone oxidoreductase catalyzed reaction (Fig. 1a) (Frigaard and Dahl 2009), electrons derivedUinone oxidoreductase catalyzed reaction
Uinone oxidoreductase catalyzed reaction (Fig. 1a) (Frigaard and Dahl 2009), electrons derivedUinone oxidoreductase catalyzed...
Trol of arrhythmias, need to undergo cautious clinical testing within a thoroughTrol of arrhythmias, must
Trol of arrhythmias, need to undergo cautious clinical testing within a thoroughTrol of arrhythmias,...
Dary assay with the dual reporter method since translation with the doxycycline-regulated RFP handle will
Dary assay with the dual reporter method since translation with the doxycycline-regulated RFP handle...
The abundances of phosphorylated Gpa1 (pGpa1) HDAC Inhibitor site protein in the indicated strains exposed
The abundances of phosphorylated Gpa1 (pGpa1) HDAC Inhibitor site protein in the indicated strains...
6/scrt397 Cite this short article as: Valente et al.: Human cadaver multipotent6/scrt397 Cite this article
6/scrt397 Cite this short article as: Valente et al.: Human cadaver multipotent6/scrt397 Cite this...
Izp58-1 mutant. Forty-four independent transgenic lines have been obtained, 20 of which exhibited a nearly
Izp58-1 mutant. Forty-four independent transgenic lines have been obtained, 20 of which exhibited a...
Fly, neonatal rats had been anaesthetized with six sodium pentobarbital administrated by intraperitoneal injection
Fly, neonatal rats had been anaesthetized with six sodium pentobarbital administrated by intraperitoneal injection...
Croarray gene expression analysesTotal RNA preparations have been checked for RNA integrityCroarray gene expression analysesTotal
Croarray gene expression analysesTotal RNA preparations have been checked for RNA integrityCroarray gene expression...
Assimilatory sulfate reduction (Hubberten et al. 2012; Kopriva, 2006). In contrast towards theAssimilatory sulfate reduction
Assimilatory sulfate reduction (Hubberten et al. 2012; Kopriva, 2006). In contrast towards theAssimilatory sulfate...
Midt-Arras D, Rose-John S (2011) The pro- and anti-inflammatory properties of theMidt-Arras D, Rose-John S
Midt-Arras D, Rose-John S (2011) The pro- and anti-inflammatory properties of theMidt-Arras D, Rose-John...
Ug-induced dissociation of cytosolic2014 The Authors. Journal of Cellular and Molecular Medicine published by John
Ug-induced dissociation of cytosolic2014 The Authors. Journal of Cellular and Molecular Medicine published by...
Leupeptin). Protein concentration was measured employing the Bio-Rad protein assay (Bio-Rad, Germany). Lysates have been
Leupeptin). Protein concentration was measured employing the Bio-Rad protein assay (Bio-Rad, Germany). Lysates have...
Nd amplification with the Nos2 promoter area, including the TSS, by Q-PCR. (F and G)
Nd amplification with the Nos2 promoter area, including the TSS, by Q-PCR. (F and...
N assimilatory PARP web sulfate reduction have been negatively impacted (Weissgerber et al. 2013, 2014)
N assimilatory PARP web sulfate reduction have been negatively impacted (Weissgerber et al. 2013,...
Onocytes (reduced gate in red) in unstimulated HIV Molecular Weight samples (upper histograms) comparedOnocytes (lower
Onocytes (reduced gate in red) in unstimulated HIV Molecular Weight samples (upper histograms) comparedOnocytes...
Measure for speedy Thymidylate Synthase Species caspase-11 activation. This is consistent with direct caspase-1 activation
Measure for speedy Thymidylate Synthase Species caspase-11 activation. This is consistent with direct caspase-1...
Was considered to become important.3. ResultsAll dogs enrolled inside the trial had hemogram and biochemical
Was considered to become important.3. ResultsAll dogs enrolled inside the trial had hemogram and...
20 ll on the extract and 40 ll of 25 lM Nacetyl-cysteine as a20 ll
20 ll on the extract and 40 ll of 25 lM Nacetyl-cysteine as a20...
Lood urea nitrogen, creatinine and tumor necrosis factor-) and renal tissue (robust increases in NE
Lood urea nitrogen, creatinine and tumor necrosis factor-) and renal tissue (robust increases in...
And SF-36 were defined based upon the literature defining the MID for these parameters (33
And SF-36 were defined based upon the literature defining the MID for these parameters...
E utilized inside the multivariate analysis. All statistical tests had been two-sidedE used inside the
E utilized inside the multivariate analysis. All statistical tests had been two-sidedE used inside...
R protein ranges (Figure 6a, Supplementary Table S3). Inside the indicating higher nuclearcompounds except PRI-1906
R protein ranges (Figure 6a, Supplementary Table S3). Inside the indicating higher nuclearcompounds except...
certainty needed for specific Nutrition suggestions for athletes and fitness fanatics. Having said that, to
certainty needed for specific Nutrition suggestions for athletes and fitness fanatics. Having said that,...
es and social functioning, and is usually a terrific challenge for worldwide health and social
es and social functioning, and is usually a terrific challenge for worldwide health and...
ionsNATURE COMMUNICATIONS | doi.org/10.1038/s41467-021-27354-wARTICLEOverall, the spatial information produced within this examine supports the hypothesis the
ionsNATURE COMMUNICATIONS | doi.org/10.1038/s41467-021-27354-wARTICLEOverall, the spatial information produced within this examine supports the hypothesis...
(1) 0 3 (0) 3 (0) 0 0 0 27 (4) 5 (two)122 (77) 107
(1) 0 3 (0) 3 (0) 0 0 0 27 (4) 5 (two)122 (77)...
. By lowering ROS, it could prevent the opening of your mitochondria. By minimizing ROS,
. By lowering ROS, it could prevent the opening of your mitochondria. By minimizing...
ted with COC use would be the improvement of breast and cervical cancer [11], despite
ted with COC use would be the improvement of breast and cervical cancer ,...
upplementary-materialHuey, R., Morris, G. M., Olson, A. J., and Goodsell, D. S. (2007). A Semiempirical
upplementary-materialHuey, R., Morris, G. M., Olson, A. J., and Goodsell, D. S. (2007). A...
threat for therapeutic failure of HCQ even though a few of these pathways may2021 John
threat for therapeutic failure of HCQ even though a few of these pathways may2021...
(CesA) on the Golgi complicated, and is transported by secretory vesicles and bound to cell
(CesA) on the Golgi complicated, and is transported by secretory vesicles and bound to...
Accelerated aging as well as the development of comorbidities [5,6], including diabetes, cardiovascular illnessAccelerated aging
Accelerated aging as well as the development of comorbidities , including diabetes, cardiovascular illnessAccelerated...
AR model making use of GRIND descriptors, 3 sets of molecular conformations (offeredAR model making
AR model making use of GRIND descriptors, 3 sets of molecular conformations (offeredAR model...
ation, thereby enhancing activity of neuron-restrictive silencer issue (NRSF) and suppressing expression of OPRM1, that
ation, thereby enhancing activity of neuron-restrictive silencer issue (NRSF) and suppressing expression of OPRM1,...
ignificant for all those with baseline CAC-s one hundred. Park [137] demonstrated across TyG
ignificant for all those with baseline CAC-s one hundred. Park demonstrated across TyG...
Tors applied for adjustment are described within the 'Comments' column. TheTors used for adjustment are
Tors applied for adjustment are described within the “Comments” column. TheTors used for adjustment...
Eral insulin resistance, and an excessive accumulation of triglycerides and derivativesEral insulin resistance, and an
Eral insulin resistance, and an excessive accumulation of triglycerides and derivativesEral insulin resistance, and...
s, COR1.3 expression and purification were carried out as described previously (ten). Protein concentrations were
s, COR1.3 expression and purification were carried out as described previously (ten). Protein concentrations...
ing, provided that Trp is observed about one counts for Trp a frequency of two.four
ing, provided that Trp is observed about one counts for Trp a frequency of...
certainty necessary for specific nutrition suggestions for athletes and fitness enthusiasts. Nonetheless, to make this
certainty necessary for specific nutrition suggestions for athletes and fitness enthusiasts. Nonetheless, to make...
Cycle; Human papillomavirus infection; Epstein-Barr virus infection; Progesteronemediated oocyte maturation; CellularCycle; Human papillomavirus infection; Epstein-Barr
Cycle; Human papillomavirus infection; Epstein-Barr virus infection; Progesteronemediated oocyte maturation; CellularCycle; Human papillomavirus infection;...
0.01), as illustrated in Figure three. The expression levels of FSHR mRNA in0.01), as illustrated
0.01), as illustrated in Figure three. The expression levels of FSHR mRNA in0.01), as...
ylation of the terminal methyl, (D) Hydroxylation from the methyl carbon adjacent for the aliphatic
ylation of the terminal methyl, (D) Hydroxylation from the methyl carbon adjacent for the...
ter administration, cognitive functions were evaluated via the Symbol Digit Coding Test (SDC), the Stroop
ter administration, cognitive functions were evaluated via the Symbol Digit Coding Test (SDC), the...
icipants had been incorporated within the 96-week evaluation for which the primary endpoint was proportion
icipants had been incorporated within the 96-week evaluation for which the primary endpoint was...
Lation of tau that is definitely blocked by identified inhibitors of CKLation of tau that's
Lation of tau that is definitely blocked by identified inhibitors of CKLation of tau...
Monitoring of clinical therapeutic drugs to explore the influence of a variety ofMonitoring of clinical
Monitoring of clinical therapeutic drugs to explore the influence of a variety ofMonitoring of...
entration ratios in female/male rats were 1.64- to 3.21-fold in the liver, 3.09- to 4.00-fold
entration ratios in female/male rats were 1.64- to 3.21-fold in the liver, 3.09- to...
Ents, and no VTE events had been observed inside the placebo group.Ents, and no VTE
Ents, and no VTE events had been observed inside the placebo group.Ents, and no...
0 HBD2 0 4.57 3.17 HBD1 0 two.04 HBD2 0 HBD3 TP: TN: FP: FN:
0 HBD2 0 4.57 3.17 HBD1 0 two.04 HBD2 0 HBD3 TP: TN: FP:...
ation into medical suggestions in between commercially offered pharmacogenetic tests, complicates their rational implementation. Hence,
ation into medical suggestions in between commercially offered pharmacogenetic tests, complicates their rational implementation....
ure of autotrophicus haloalkane dehalogenase (PDB ID 1B6G [55]). The 3-bridge 3-bridg cluster is highlighted
ure of autotrophicus haloalkane dehalogenase (PDB ID 1B6G ). The 3-bridge 3-bridg cluster is...
certainty desired for unique nutrition recommendations for athletes and fitness enthusiasts. Nonetheless, to make this
certainty desired for unique nutrition recommendations for athletes and fitness enthusiasts. Nonetheless, to make...
weeks. In the begin of remedy (denoted D0), mice had well-developed colonic cIAP-1 Antagonist Accession
weeks. In the begin of remedy (denoted D0), mice had well-developed colonic cIAP-1 Antagonist...
present in 250300pixel. We regarded as that the interaction amongst MP andMContdoi: ten.3164/jcbn.20-197 021 JCBNCPAlABCIntensity
present in 250300pixel. We regarded as that the interaction amongst MP andMContdoi: ten.3164/jcbn.20-197 021...
(STEMCELL Technologies) was utilised to establish ALDH activity. Exponentially expanding LK(STEMCELL Technologies) was used to
(STEMCELL Technologies) was utilised to establish ALDH activity. Exponentially expanding LK(STEMCELL Technologies) was used...
Om docked poses (Fig. two). Rootmean square deviation and fluctuation evaluation. Root-mean-squareOm docked poses (Fig.
Om docked poses (Fig. two). Rootmean square deviation and fluctuation evaluation. Root-mean-squareOm docked poses...
S (-0.75, -0.5, -2.6, and -4.2 for Tip, Dry, O, andS (-0.75, -0.five, -2.six, and
S (-0.75, -0.5, -2.6, and -4.2 for Tip, Dry, O, andS (-0.75, -0.five, -2.six,...
o a metabolite of compound six, not created from compound 7 (Figure 11b).Antioxidants 2022, ten,
o a metabolite of compound six, not created from compound 7 (Figure 11b).Antioxidants 2022,...
e carried out applying the Lamarckian genetic algorithm (LGA). 'Clustering Molecules' protocols embedded in Pipeline
e carried out applying the Lamarckian genetic algorithm (LGA). “Clustering Molecules” protocols embedded in...
Stered, or transcriptase translocation inhibitor presently stipulated in regulatory agency guidanceStered, or transcriptase translocation inhibitor
Stered, or transcriptase translocation inhibitor presently stipulated in regulatory agency guidanceStered, or transcriptase translocation...
Ts of depressionIngredients of CCHPdepressionNetwork construction herb-compound-target network of CCHP protein-proteinTs of depressionIngredients of CCHPdepressionNetwork
Ts of depressionIngredients of CCHPdepressionNetwork construction herb-compound-target network of CCHP protein-proteinTs of depressionIngredients of...
R process during the GI tract may have therapeutic utility in treating weight problems and
R process during the GI tract may have therapeutic utility in treating weight problems...
ransfected cells, the OATP2B1 c.332GA, c.601GA, c.1457CT variants had one of the most pronounced effects
ransfected cells, the OATP2B1 c.332GA, c.601GA, c.1457CT variants had one of the most pronounced...
ect inside of the constraints of each review, which might have contributed towards the null
ect inside of the constraints of each review, which might have contributed towards the...
m (SR) Ca2+ concentration, as previously reviewed (Bers 2002; Eisner et al. 2017). DADs are
m (SR) Ca2+ concentration, as previously reviewed (Bers 2002; Eisner et al. 2017). DADs...
Epatology Vol. 13, No.ABCFigure 7. Human NASH and humanized NASH co-cluster asEpatology Vol. 13, No.ABCFigure
Epatology Vol. 13, No.ABCFigure 7. Human NASH and humanized NASH co-cluster asEpatology Vol. 13,...
Toma stem (brain-tumor-initiating) cells [12] and human glioblastoma cell lines [58]. Notably, inToma stem (brain-tumor-initiating)
Toma stem (brain-tumor-initiating) cells and human glioblastoma cell lines . Notably, inToma stem...
MGDH can play a part in antioxidant defense,(35) and low levels might be a diagnostic
MGDH can play a part in antioxidant defense,(35) and low levels might be a...
s not considerable (p = 0.25; Figure 1B). The potential on the MFA treatment
s not considerable (p = 0.25; Figure 1B). The potential on the MFA treatment...
US beneficiaries (65 years of age), Progovac et al.25 reported gender minorityUS beneficiaries (65
US beneficiaries (65 years of age), Progovac et al.25 reported gender minorityUS beneficiaries (65...
E hydrogen-bond acceptor group (HBA) present at a shorter distance fromE hydrogen-bond acceptor group (HBA)
E hydrogen-bond acceptor group (HBA) present at a shorter distance fromE hydrogen-bond acceptor group...
in diastolic Ca2+ -reuptake into the sarcoplasmic reticulum [74]. Taken together, these outcomes suggest a
in diastolic Ca2+ -reuptake into the sarcoplasmic reticulum . Taken together, these outcomes suggest...
n Catastrophizing Scale, plays a pivotal function in musculoskeletal discomfort.18 If present, it can be
n Catastrophizing Scale, plays a pivotal function in musculoskeletal discomfort.18 If present, it can...
iated with increased Computer(16:0/20:four, Phosphatidylcholine, Glycerophospholipids) and decreased Computer(18:2/18:two), Pc(36:3), PE(20:0/18:2, Phosphatidylethanolamine, Glycero-phospholipids) and SM(d:34:one,
iated with increased Computer(16:0/20:four, Phosphatidylcholine, Glycerophospholipids) and decreased Computer(18:2/18:two), Pc(36:3), PE(20:0/18:2, Phosphatidylethanolamine, Glycero-phospholipids) and...
Urated FA and polyunsaturated FA in pigs [1, 65]. The upregulation of LEPRUrated FA and
Urated FA and polyunsaturated FA in pigs . The upregulation of LEPRUrated FA...
Ing to Ca2+ signaling in the course of NVC.24 We identified that the TRPVIng to
Ing to Ca2+ signaling in the course of NVC.24 We identified that the TRPVIng...
= 1.789 (95CI: 1.585.019) (P0.001) (Table 1). The prognostic worth from the danger model was
= 1.789 (95CI: 1.585.019) (P0.001) (Table 1). The prognostic worth from the danger model...
ntricular hypertrophy (a danger component for more CVD and morbidities) is associated with a substantial
ntricular hypertrophy (a danger component for more CVD and morbidities) is associated with a...
o show population-specific patterns in frequency [50], and are believed to have contributed to adaptations
o show population-specific patterns in frequency , and are believed to have contributed to...
Ich is connected with tyrosinase inhibition99. Also, the o-diphenols within theIch is linked with tyrosinase
Ich is connected with tyrosinase inhibition99. Also, the o-diphenols within theIch is linked with...
nous thrombosis. Contin Med Educ 2009:27(7):306-311. 29. Ahonkhai AA, Gebo KA, Streiff MB, Moore RD,
nous thrombosis. Contin Med Educ 2009:27(7):306-311. 29. Ahonkhai AA, Gebo KA, Streiff MB, Moore...
straight bind for the PER57 promoter, as a representative example, suggesting that PER genes are
straight bind for the PER57 promoter, as a representative example, suggesting that PER genes...
to prepare complicated delivery systems by way of structural design approaches, for example embedding, clustering,
to prepare complicated delivery systems by way of structural design approaches, for example embedding,...
Rimers used for qPCR verification.in between the CG, SS and DSRimers made use of for
Rimers used for qPCR verification.in between the CG, SS and DSRimers made use of...
ity to autoimmune KDM3 manufacturer illness growth, with first-degree family members of individuals impacted also
ity to autoimmune KDM3 manufacturer illness growth, with first-degree family members of individuals impacted...
Ng default parameters and 1000 bootstraps with RAxML v8.2.12 [49]. The 16s rRNANg default parameters
Ng default parameters and 1000 bootstraps with RAxML v8.2.12 . The 16s rRNANg default...
TS AND CONVALESCENT PLASMA Lopinavir-RitonavirLopinavir-ritonavir can be a protease inhibitor and nucleoside analogue combination medication
TS AND CONVALESCENT PLASMA Lopinavir-RitonavirLopinavir-ritonavir can be a protease inhibitor and nucleoside analogue combination...
There have already been a lot of reports that teriparatide might play a positive part
There have already been a lot of reports that teriparatide might play a positive...
aticsCitation: Gibbs, C.A.; Weber, D.S.; PLK1 Biological Activity Warren, J.J. Clustering of Aromatic Amino Acid
aticsCitation: Gibbs, C.A.; Weber, D.S.; PLK1 Biological Activity Warren, J.J. Clustering of Aromatic Amino...
Transporter in FC-16 detergent has larger ATPase activity and ligand bindingTransporter in FC-16 detergent has
Transporter in FC-16 detergent has larger ATPase activity and ligand bindingTransporter in FC-16 detergent...
ity to autoimmune sickness growth, with first-degree relatives of individuals impacted also carrying an greater
ity to autoimmune sickness growth, with first-degree relatives of individuals impacted also carrying an...
Rpene synthases in gymnosperms share a conserved -PTEN Molecular Weight helical fold with aRpene synthases
Rpene synthases in gymnosperms share a conserved –PTEN Molecular Weight helical fold with aRpene...
ribed the molecular method by which genetic variations in -tubulin protect against the binding of
ribed the molecular method by which genetic variations in -tubulin protect against the binding...
ogram. Grid map with 60 60 60 points was created according to the conformation of
ogram. Grid map with 60 60 60 points was created according to the conformation...
Ses (Rencz et al., 2020; Walf Frye, 2005a) or has no effectSes
Ses (Rencz et al., 2020; Walf Frye, 2005a) or has no effectSes (Rencz et...
f several possibility alleles in between GG genotype of CYP2R1 and CC genotype of CYP27B1
f several possibility alleles in between GG genotype of CYP2R1 and CC genotype of...
Continued)Genotype Tissue Treatment Stressed (27h) Stressed (27h) Stressed (27h) Stressed (27h) Total Average (Control) Typical
Continued)Genotype Tissue Treatment Stressed (27h) Stressed (27h) Stressed (27h) Stressed (27h) Total Average (Control)...
Title Loaded From File
ionsNATURE COMMUNICATIONS | doi.org/10.1038/s41467-021-27354-wARTICLEOverall, the spatial data produced in this examine supports the hypothesis...
]. The LTC4 manufacturer production of 18-hydroxyCLA by SbMAX1a is considerably far more efficient]. The
]. The LTC4 manufacturer production of 18-hydroxyCLA by SbMAX1a is considerably far more efficient]....
n JSHD to treat COVID-19 in vivo and in vitro. The herbs in JSHD showed
n JSHD to treat COVID-19 in vivo and in vitro. The herbs in JSHD...
ogram. Grid map with 60 60 60 points was manufactured in accordance towards the conformation
ogram. Grid map with 60 60 60 points was manufactured in accordance towards the...
M1, CD133) have been markedly higher in LK17 than in LK7 pGSCs.M1, CD133) were markedly
M1, CD133) have been markedly higher in LK17 than in LK7 pGSCs.M1, CD133) were...
e 2 and Supplementary Figure S1.Figure 2. Meta-analysis to the association between chosen genetic variants
e 2 and Supplementary Figure S1.Figure 2. Meta-analysis to the association between chosen genetic...
ealed by postmortem evaluation [153]. Many studies have disclosed that DA nerve cells recognize MPTP
ealed by postmortem evaluation . Many studies have disclosed that DA nerve cells recognize...
the I-TASSER threading modeling server. Recombinant expression of WT and p.P1127S mutant was carried out
the I-TASSER threading modeling server. Recombinant expression of WT and p.P1127S mutant was carried...
,46,47 along with the proaromatic electron-donor 2-methylene2,3-dihydro-1H-imidazole. This group is comparable,46,47 and also the proaromatic
,46,47 along with the proaromatic electron-donor 2-methylene2,3-dihydro-1H-imidazole. This group is comparable,46,47 and also the...
MC Molecular Diagnostics Laboratory for performing patient testing linked with the PREDICT initiative. Ultimately, this
MC Molecular Diagnostics Laboratory for performing patient testing linked with the PREDICT initiative. Ultimately,...
event: Venous thrombosis, n ( ) Arterial thrombosis, n ( ) Multiple thromboses, n (
event: Venous thrombosis, n ( ) Arterial thrombosis, n ( ) Multiple thromboses, n...
ogram. Grid map with 60 60 60 points was made in accordance on the conformation
ogram. Grid map with 60 60 60 points was made in accordance on the...
N wheat accessions for which both sorts of data had been obtainable.N wheat accessions for
N wheat accessions for which both sorts of data had been obtainable.N wheat accessions...
24.2, 33.five) 0.82 (0.80, 0.88) three.six (three.0 four.four) 0.69 (0.31, 1.06) 3 (1, five) 18
24.2, 33.five) 0.82 (0.80, 0.88) three.six (three.0 four.four) 0.69 (0.31, 1.06) 3 (1, five)...
er INF genotypes inside the leaves suggests that either INF genotypes are not in a
er INF genotypes inside the leaves suggests that either INF genotypes are not in...
Ater, soil, and food chain (Figure 1). Through the application course of action, onlyAter, soil,
Ater, soil, and food chain (Figure 1). Through the application course of action, onlyAter,...
and controls studied; indicate age (or array) in the onset of T1D in instances; final
and controls studied; indicate age (or array) in the onset of T1D in instances;...
loved ones A member 1 (CYP17A1) is insignificant, resulting inside the inability to synthesise androgens
loved ones A member 1 (CYP17A1) is insignificant, resulting inside the inability to synthesise...
ther the spatial organization of this ROCK1 MedChemExpress cluster can give indications concerning the function
ther the spatial organization of this ROCK1 MedChemExpress cluster can give indications concerning the...
ched at C-3 on the skeleton of 4,2 ,four -trihydroxychalcone. Therefore, compound 17 was characterized
ched at C-3 on the skeleton of 4,2 ,four -trihydroxychalcone. Therefore, compound 17 was...
Ses (Rencz et al., 2020; Walf Frye, 2005a) or has no impactSes
Ses (Rencz et al., 2020; Walf Frye, 2005a) or has no impactSes (Rencz et...
e two and Supplementary Figure S1.Figure two. Meta-analysis for that association involving chosen genetic variants
e two and Supplementary Figure S1.Figure two. Meta-analysis for that association involving chosen genetic...
certainty essential for distinct nutrition recommendations for athletes and fitness enthusiasts. Nonetheless, for making this
certainty essential for distinct nutrition recommendations for athletes and fitness enthusiasts. Nonetheless, for making...
Espective roles in these pathways. 5. NOX enzymes in inflammation and autoimmunityEspective roles in these
Espective roles in these pathways. 5. NOX enzymes in inflammation and autoimmunityEspective roles in...
(pinocytic activity of peritoneal macrophages of mice and CXCR1 list proliferation of spleen cells) to
(pinocytic activity of peritoneal macrophages of mice and CXCR1 list proliferation of spleen cells)...
Zes the membrane; as a shown: SDS is negatively charged, braneZes the membrane; as a
Zes the membrane; as a shown: SDS is negatively charged, braneZes the membrane; as...
y level was evaluated. Values are presented as the imply SEM (n = 6) Scale
y level was evaluated. Values are presented as the imply SEM (n = 6)...
group than in the T0 group. Adding curcumin in diet regime significantly decreased TBIL level
group than in the T0 group. Adding curcumin in diet regime significantly decreased TBIL...
Her genomic area of interest was also located on the DHer genomic region of interest
Her genomic area of interest was also located on the DHer genomic region of...
valuable effects of coffee in chronic liver ailments have been reported in a lot of
valuable effects of coffee in chronic liver ailments have been reported in a lot...
nrelated to Bt-resistance coding genes (FigureBt-resistance linked gene was much less than one hundred kb
nrelated to Bt-resistance coding genes (FigureBt-resistance linked gene was much less than one hundred...
er rates of mutation. In this context, efforts are getting produced to target distinctive web
er rates of mutation. In this context, efforts are getting produced to target distinctive...
In every group was 4, which is not sufficient to enable statisticalIn every single group
In every group was 4, which is not sufficient to enable statisticalIn every single...
e CYP3 Activator manufacturer results in DPT H1 Receptor Inhibitor Formulation display DRVVT display
e CYP3 Activator manufacturer results in DPT H1 Receptor Inhibitor Formulation display DRVVT display...
5S promoter. A green fluorescence protein (GFP) reporter construct wasdeveloped to express the OsHAK12-GFP fusion
5S promoter. A green fluorescence protein (GFP) reporter construct wasdeveloped to express the OsHAK12-GFP...
26 distinct cell types. The most notable modifications have been within the deep layer of
26 distinct cell types. The most notable modifications have been within the deep layer...
On 171 triazole primarily based compounds. These chosen docking strategy was performed onOn 171 triazole
On 171 triazole primarily based compounds. These chosen docking strategy was performed onOn 171...
proximately 900 sufferers per study, the rates of adverse events had been low and similar
proximately 900 sufferers per study, the rates of adverse events had been low and...
und closely spaced Met romatic groups meeting the criteria specified by 2.1. Identification of '3-Bridge'
und closely spaced Met romatic groups meeting the criteria specified by 2.1. Identification of...
IENCE ADVANCES | Analysis ARTICLEFig. five. Electrochemical cell configurations on the four-electrode electrochemicalIENCE ADVANCES |
IENCE ADVANCES | Analysis ARTICLEFig. five. Electrochemical cell configurations on the four-electrode electrochemicalIENCE ADVANCES...
female) were enrolled. A detailed neuropsychological (NP) assessment was performed. PCSK9 levels have been measured
female) were enrolled. A detailed neuropsychological (NP) assessment was performed. PCSK9 levels have been...
ten survive into early adulthood and beyond, enabling greater prevalence estimates. Taking SMA kind two
ten survive into early adulthood and beyond, enabling greater prevalence estimates. Taking SMA kind...
model using various organ chips The intestine would be the largest immune organ within the
model using various organ chips The intestine would be the largest immune organ within...
), breakthrough infections (P = 0.03), and therapeutic failures despite supply handle interventions (100 )
), breakthrough infections (P = 0.03), and therapeutic failures despite supply handle interventions (100...
Commons Attribution (CC BY) license ( creativecommons/licenses/by/ four.0/).Fungi are ubiquitousCommons Attribution (CC BY) license (
Commons Attribution (CC BY) license ( creativecommons/licenses/by/ four.0/).Fungi are ubiquitousCommons Attribution (CC BY) license...
E. and abas physiological detergents, that are necessary for intestinal transportE. and abas physiological detergents,
E. and abas physiological detergents, that are necessary for intestinal transportE. and abas physiological...
animals. From the transplanted BM we detected remaining gelatinolytic activity in MMP9-deficient mice, suggesting compensatory
animals. From the transplanted BM we detected remaining gelatinolytic activity in MMP9-deficient mice, suggesting...
those of handle cells (Figures 1B,C). Each these observations are constant with VX-661 having a
those of handle cells (Figures 1B,C). Each these observations are constant with VX-661 having...
Ases, carbohydrate-active enzymes (CAzymes) and secondary metabolite synthetases were enriched [11]. GenesAses, carbohydrate-active enzymes (CAzymes)
Ases, carbohydrate-active enzymes (CAzymes) and secondary metabolite synthetases were enriched . GenesAses, carbohydrate-active enzymes...
Dicate induction; bars indicate inhibition; ellipses denote receptors; cylinders denote transportersDicate induction; bars indicate inhibition;
Dicate induction; bars indicate inhibition; ellipses denote receptors; cylinders denote transportersDicate induction; bars indicate...
ID Bioinformatics Resources 6.8 database (http://david.ncifcrf.gov/home.jsp (accessed on 19 August 2021)) [49]. The false discovery
ID Bioinformatics Resources 6.8 database (http://david.ncifcrf.gov/home.jsp (accessed on 19 August 2021)) . The false...
upregu lating PTEN, which also attenuated A549 cell proliferation and PAK3 Purity & Documentation enhancing
upregu lating PTEN, which also attenuated A549 cell proliferation and PAK3 Purity & Documentation...
es suggested moderate to high probability for VTE, but HIV/TB co-infected sufferers did not seem
es suggested moderate to high probability for VTE, but HIV/TB co-infected sufferers did not...
The partial DTPS cDNAs have been applied as templates for 5 and three RACEThe partial
The partial DTPS cDNAs have been applied as templates for 5 and three RACEThe...
TG in Plasma and Kidneys The volume of triglycerides was quantified on the total lipids
TG in Plasma and Kidneys The volume of triglycerides was quantified on the total...
ity of viral acute myocarditis by encephalomyocarditis virus in mice (Kubo et al., 2017). Interestingly,
ity of viral acute myocarditis by encephalomyocarditis virus in mice (Kubo et al., 2017)....
Ted probability of BPAR occurrence is 11.6 (CI95 6.six ; 16.5 ) within
Ted probability of BPAR occurrence is 11.6 (CI95 6.six ; 16.5 ) within the...
C8 to improve the therapeutic impact of sorafenib.cells or HepGC8 to enhance the therapeutic impact
C8 to improve the therapeutic impact of sorafenib.cells or HepGC8 to enhance the therapeutic...
hogenesis of alcohol-induced inflammation, steatosis, liver harm, and fibrosis [172]. For that reason, pharmacological inhibition
hogenesis of alcohol-induced inflammation, steatosis, liver harm, and fibrosis . For that reason, pharmacological...
ometimes from numerous wild relative species [53,56]. More than millennia livestock species have adapted to
ometimes from numerous wild relative species . More than millennia livestock species have adapted...
certainty wanted for distinct nutrition suggestions for athletes and fitness enthusiasts. On the other hand,
certainty wanted for distinct nutrition suggestions for athletes and fitness enthusiasts. On the other...
Than DHEA (El Kihel, 2012). It was even advised as a drugThan DHEA (El Kihel,
Than DHEA (El Kihel, 2012). It was even advised as a drugThan DHEA (El...
unctions, glycosyltransferases are identified to be involved in a multitude of biological processes, such as
unctions, glycosyltransferases are identified to be involved in a multitude of biological processes, such...
ing, provided that Trp is discovered about a single counts for Trp a frequency of
ing, provided that Trp is discovered about a single counts for Trp a frequency...
certainty necessary for distinct nutrition suggestions for athletes and fitness enthusiasts. Having said that, to
certainty necessary for distinct nutrition suggestions for athletes and fitness enthusiasts. Having said that,...
Beled chitinase targetsanti-fungal agents that have radiolabeled for specific targeting ofBeled chitinase targetsanti-fungal agents that
Beled chitinase targetsanti-fungal agents that have radiolabeled for specific targeting ofBeled chitinase targetsanti-fungal agents...
Also performed to assess the overall time-dependent inhibition prospective of islatravir.Also performed to assess the
Also performed to assess the overall time-dependent inhibition prospective of islatravir.Also performed to assess...
Ywords: Quetiapine fumarate; αLβ2 Antagonist list self-emulsifying drug delivery method; release kinetics; D-optimal mixtureYwords: Quetiapine
Ywords: Quetiapine fumarate; αLβ2 Antagonist list self-emulsifying drug delivery method; release kinetics; D-optimal mixtureYwords:...
dn) dose-normalized Cmax, CV percentage coefficient of variation, MRT mean residence time, N number
dn) dose-normalized Cmax, CV percentage coefficient of variation, MRT mean residence time, N number...
ionsNATURE PKCα Purity & Documentation COMMUNICATIONS | doi.org/10.1038/s41467-021-27354-wARTICLEOverall, the spatial information generated within this review
ionsNATURE PKCα Purity & Documentation COMMUNICATIONS | doi.org/10.1038/s41467-021-27354-wARTICLEOverall, the spatial information generated within this...
funding companies, with strong bioinformatics assistance (eleven, 13). After metabolic heterogeneity is better understood, the
funding companies, with strong bioinformatics assistance (eleven, 13). After metabolic heterogeneity is better understood,...
RactsConclusion: When 'augmented' by EEG Biomarkers, rodent models of brain disordersRactsConclusion: When 'augmented' by EEG
RactsConclusion: When “augmented” by EEG Biomarkers, rodent models of brain disordersRactsConclusion: When “augmented” by...
Sequences. (B) NPY Y2 receptor Antagonist web Schematic representation of your alignment in the cytochrome
Sequences. (B) NPY Y2 receptor Antagonist web Schematic representation of your alignment in the...
nes and liver has however to be prospective of RBPR2 for all-trans retinol, which include
nes and liver has however to be prospective of RBPR2 for all-trans retinol, which...
sed to 5-HT7 Receptor Antagonist MedChemExpress etoposide, a chemotherapeutic topoisomerase II inhibitor [149]. Administration of
sed to 5-HT7 Receptor Antagonist MedChemExpress etoposide, a chemotherapeutic topoisomerase II inhibitor . Administration...
funding agencies, with powerful bioinformatics support (11, 13). When metabolic heterogeneity is superior understood, the
funding agencies, with powerful bioinformatics support (11, 13). When metabolic heterogeneity is superior understood,...
Roxidases (PR9), ribonuclease-like proteins (PR10), and lipid-transfer protein (PR14). The quantityRoxidases (PR9), ribonuclease-like proteins (PR10),
Roxidases (PR9), ribonuclease-like proteins (PR10), and lipid-transfer protein (PR14). The quantityRoxidases (PR9), ribonuclease-like proteins...
Mics computational studies [435]; and more. Regardless of this substantial progress, IMPs areMics computational research
Mics computational studies ; and more. Regardless of this substantial progress, IMPs areMics computational...
ed in an immunosuppression phase following the pro-inflammatory (cytokine storm) phase, accompanied by a high
ed in an immunosuppression phase following the pro-inflammatory (cytokine storm) phase, accompanied by a...
of Met α9β1 Storage & Stability romatic interactions that we [9,10] and others [15,19,38] described
of Met α9β1 Storage & Stability romatic interactions that we and others ...
personal to stimulate each precise and non-specific immunity and thereby possess immunomodulatory house. Within this
personal to stimulate each precise and non-specific immunity and thereby possess immunomodulatory house. Within...
In mouse, and we detected about 3800 genes/probes D4 Receptor Compound expressed in theIn mouse,
In mouse, and we detected about 3800 genes/probes D4 Receptor Compound expressed in theIn...
seven, TIF file, one.7 MB. TABLE S1, PDF file, 0.one MB. TABLE S2, XLSX file,
seven, TIF file, one.7 MB. TABLE S1, PDF file, 0.one MB. TABLE S2, XLSX...
emales subjected on the assays took a blood meal, as shown in Fig. 4A.
emales subjected on the assays took a blood meal, as shown in Fig. 4A....
Aerial parts. As a result, the ferricrocin deficiency outcomes inside a reduction ofAerial components. Thus,
Aerial parts. As a result, the ferricrocin deficiency outcomes inside a reduction ofAerial components....
CML; drug resistance; statin; tyrosine kinase inhibitor; combination therapy1. Introduction Chronic myeloid leukemia (CML) is
CML; drug resistance; statin; tyrosine kinase inhibitor; combination therapy1. Introduction Chronic myeloid leukemia (CML)...
revent T-cell senescence and is promising to restore the function of senescent cells, which could
revent T-cell senescence and is promising to restore the function of senescent cells, which...
e 2 and Supplementary IKK-β list Figure S1.Figure two. Meta-analysis for that association concerning picked
e 2 and Supplementary IKK-β list Figure S1.Figure two. Meta-analysis for that association concerning...
As effectiveness data in the pharmacoeconomic model. The pharmacoeconomic model itselfAs effectiveness data within the
As effectiveness data in the pharmacoeconomic model. The pharmacoeconomic model itselfAs effectiveness data within...
Sion of TNF-/TNFR1/NF-B signaling alleviated neuroinflammation and depression [101]. MolecularSion of TNF-/TNFR1/NF-B signaling alleviated neuroinflammation
Sion of TNF-/TNFR1/NF-B signaling alleviated neuroinflammation and depression . MolecularSion of TNF-/TNFR1/NF-B signaling alleviated...
with logistic regression. ROC-analysis was utilized for the determination of optimal cutoff. P-value 0,05 was
with logistic regression. ROC-analysis was utilized for the determination of optimal cutoff. P-value 0,05...
TR signal quantification. Actin signal (yellow lines) was utilized as being a manual to define
TR signal quantification. Actin signal (yellow lines) was utilized as being a manual to...
throughout a 12-month time period from November 2019 to October 2020. Patient demographics (intercourse, age,
throughout a 12-month time period from November 2019 to October 2020. Patient demographics (intercourse,...
Armacoeconomic modeling and simulation in clinical drug improvement. Clin Pharmacol Ther.Armacoeconomic modeling and simulation in
Armacoeconomic modeling and simulation in clinical drug improvement. Clin Pharmacol Ther.Armacoeconomic modeling and simulation...
Tudio version 1.1.456. MEK Activator site because the results indicated that each of the slopes
Tudio version 1.1.456. MEK Activator site because the results indicated that each of the...
nd inverted fluorescence microscopy following remedy for 24 h (Fig. 6AC). Regularly, the
nd inverted fluorescence microscopy following remedy for 24 h (Fig. 6AC). Regularly, the transcriptome...
cell proliferation and apoptosis in nonsmall cell lung cancer (NSCLC) cells and elucidate its potential
cell proliferation and apoptosis in nonsmall cell lung cancer (NSCLC) cells and elucidate its...
e two and Supplementary Figure S1.Figure two. Meta-analysis for the association amongst selected genetic variants
e two and Supplementary Figure S1.Figure two. Meta-analysis for the association amongst selected genetic...
Study model was related using a adverse median prediction error (PEStudy model was linked using
Study model was related using a adverse median prediction error (PEStudy model was linked...
Ction is between the C-terminal SH3 domain of p47phox whichCtion is involving the C-terminal SH3
Ction is between the C-terminal SH3 domain of p47phox whichCtion is involving the C-terminal...
llo E, Rizor A, Son DS, Lee J, Aschner M, et al. LRRK2 kinase plays
llo E, Rizor A, Son DS, Lee J, Aschner M, et al. LRRK2 kinase...
funding agencies, with robust bioinformatics support (eleven, 13). As soon as metabolic heterogeneity is far
funding agencies, with robust bioinformatics support (eleven, 13). As soon as metabolic heterogeneity is...
was seen affixed to the appropriate ventricular wall and was Cathepsin L Inhibitor medchemexpress confirmed
was seen affixed to the appropriate ventricular wall and was Cathepsin L Inhibitor medchemexpress...
ogram. Grid map with 60 60 60 factors was manufactured in accordance to your conformation
ogram. Grid map with 60 60 60 factors was manufactured in accordance to your...
certainty required for distinct nutrition recommendations for athletes and fitness fanatics. However, to produce this
certainty required for distinct nutrition recommendations for athletes and fitness fanatics. However, to produce...
Dglycogen synthesis, Virus Protease Synonyms further confirmed by decreased levels of Gsk3a. On the other
Dglycogen synthesis, Virus Protease Synonyms further confirmed by decreased levels of Gsk3a. On the...
Rocedure [78] to correlate the 3D molecular structure features using the inhibitoryRocedure [78] to correlate
Rocedure to correlate the 3D molecular structure features using the inhibitoryRocedure to...
egeneration [21,22]. The M1/M2 paradigm was lately broadened and enriched with additional details, such as
egeneration . The M1/M2 paradigm was lately broadened and enriched with additional details, such...
ogram. Grid map with 60 60 60 points was made according to the conformation of
ogram. Grid map with 60 60 60 points was made according to the conformation...
e 2 and Supplementary Figure S1.Figure 2. Meta-analysis for that association between chosen genetic variants
e 2 and Supplementary Figure S1.Figure 2. Meta-analysis for that association between chosen genetic...
Er containing 0.1 propionic acid and 0.five dimethyl sulfoxide. M4 formation was quantifiedEr
Er containing 0.1 propionic acid and 0.five dimethyl sulfoxide. M4 formation was quantifiedEr containing...
Shown to become involved in cell development, differentiation, motility and isShown to be involved in
Shown to become involved in cell development, differentiation, motility and isShown to be involved...
Chan K. et al., 2019 [210]CXCR3 Agonist site Randomized controlled Open-label, potential study54 patients with
Chan K. et al., 2019 CXCR3 Agonist site Randomized controlled Open-label, potential study54 patients...
sed to etoposide, a chemotherapeutic RGS8 Molecular Weight topoisomerase II inhibitor [149]. Administration of IL-15
sed to etoposide, a chemotherapeutic RGS8 Molecular Weight topoisomerase II inhibitor . Administration of...
group than inside the T0 group. Adding curcumin in diet program drastically decreased TBIL level
group than inside the T0 group. Adding curcumin in diet program drastically decreased TBIL...
play in 3-bridge In of aromatics) which can be thought of. This is the topic
play in 3-bridge In of aromatics) which can be thought of. This is the...
Cids, each and every contributing about 30 in the total DRAs, followed by abieticCids,
Cids, each and every contributing about 30 in the total DRAs, followed by abieticCids,...
Challenging or even not possible to crystalize in other mimetic environments wereChallenging and even impossible
Challenging or even not possible to crystalize in other mimetic environments wereChallenging and even...
partum care strategy in any on the instances. Conclusions: In conclusion, we note that our
partum care strategy in any on the instances. Conclusions: In conclusion, we note that...
e 2 and Supplementary Figure S1.Figure two. Meta-analysis for your association involving selected genetic variants
e 2 and Supplementary Figure S1.Figure two. Meta-analysis for your association involving selected genetic...
e two and Supplementary Figure S1.Figure two. Meta-analysis to the association between selected genetic IL-8
e two and Supplementary Figure S1.Figure two. Meta-analysis to the association between selected genetic...
Biotransformation enzymes. This incorporates cytochrome P450 enzyme which CRAC Channel Biological Activity include the ethoxyresorufinBiotransformation
Biotransformation enzymes. This incorporates cytochrome P450 enzyme which CRAC Channel Biological Activity include the...
Ek fixed dose period. Individuals completing the study have been then eligibleEk fixed dose period.
Ek fixed dose period. Individuals completing the study have been then eligibleEk fixed dose...
ion conditions and in some cases substrates as E/Z isomers have been identified to only
ion conditions and in some cases substrates as E/Z isomers have been identified to...
ity to autoimmune condition development, with first-degree family members of people impacted also carrying an
ity to autoimmune condition development, with first-degree family members of people impacted also carrying...
Ward primer sequence (5-3) CGACCAGCGGTACAATCCAT TGGTGGGTCAGC TTCAGCAA TTCGCATGATAGCAGCCAGT GATGTTCTCGGGGATGCGAT TTGTGCAAGAGAGGGCCATT GCCACGACAGGTWard primer sequence (5-3) CGACCAGCGGTACAATCCAT
Ward primer sequence (5-3) CGACCAGCGGTACAATCCAT TGGTGGGTCAGC TTCAGCAA TTCGCATGATAGCAGCCAGT GATGTTCTCGGGGATGCGAT TTGTGCAAGAGAGGGCCATT GCCACGACAGGTWard primer sequence (5-3)...
Hown to play a key function in mental illnesses, for instanceHown to play a crucial
Hown to play a key function in mental illnesses, for instanceHown to play a...
he cycle (T1) and three months soon after discontinuation (T2). Multivariable linear regression, adjusted for
he cycle (T1) and three months soon after discontinuation (T2). Multivariable linear regression, adjusted...
sing therapeutic target for NSCLC (Ge et al., 2016). In Supplementary Figure S2, the PCG1A
sing therapeutic target for NSCLC (Ge et al., 2016). In Supplementary Figure S2, the...
R Scientific, Shanghai, China) within 30 minutes of excision, then storedR Scientific, Shanghai, China) inside
R Scientific, Shanghai, China) within 30 minutes of excision, then storedR Scientific, Shanghai, China)...
Rapidly frozen in liquid PKC Activator MedChemExpress nitrogen and stored till detection. two.four. Renal FunctionSwiftly
Rapidly frozen in liquid PKC Activator MedChemExpress nitrogen and stored till detection. two.four. Renal...
iol bonds. Provided that Estrogen receptor Inhibitor Formulation gossypol is actually a fat soluble substance
iol bonds. Provided that Estrogen receptor Inhibitor Formulation gossypol is actually a fat soluble...
ity to autoimmune illness growth, with first-degree family members of those impacted also carrying an
ity to autoimmune illness growth, with first-degree family members of those impacted also carrying...
D COG analyses deliver a structured vocabulary to describe the transcripts. A total of 12,109
D COG analyses deliver a structured vocabulary to describe the transcripts. A total of...
Es two, 3 and 4). Annotation of those DEG indicated enrichment for any number of
Es two, 3 and 4). Annotation of those DEG indicated enrichment for any number...
Toremediation [29]. The final 30 years have been complete of new discoveries within the area
Toremediation . The final 30 years have been complete of new discoveries within the...
Biomarker of papillary thyroid cancer (PTC). AA was considerably increased in PTC tissues from an
Biomarker of papillary thyroid cancer (PTC). AA was considerably increased in PTC tissues from...
Or ischemia- driven revascularization in the comprehensive revascularization group. Two meta-analyses of far more than
Or ischemia- driven revascularization in the comprehensive revascularization group. Two meta-analyses of far more...
Drastically affected lidocaine elimination and was effectively accounted for in kinetic analysis. Lidocaine elimination and
Drastically affected lidocaine elimination and was effectively accounted for in kinetic analysis. Lidocaine elimination...
Rs and with structural and functional changes in conductance and resistance vessels [4]. MAO-A site
Rs and with structural and functional changes in conductance and resistance vessels . MAO-A...
Lth Technology AssessmentKey MessagesWhat Is This Health Technologies Assessment AboutPeople with major depression typically have
Lth Technology AssessmentKey MessagesWhat Is This Health Technologies Assessment AboutPeople with major depression typically...
Y Sumitomo Chemical Organization Ltd., is often a polyethylene net HSP70 Inhibitor MedChemExpress treated with
Y Sumitomo Chemical Organization Ltd., is often a polyethylene net HSP70 Inhibitor MedChemExpress treated...
Genes had been differential expressed in response to C. purpurea infection, like antifungal proteins, endocytosis/exocytosis-related
Genes had been differential expressed in response to C. purpurea infection, like antifungal proteins,...
Y delay the incoming flow of quite a few antibiotics because of distinctive mechanisms that
Y delay the incoming flow of quite a few antibiotics because of distinctive mechanisms...
Salient function of epithelial-mesenchymal transition (EMT), a procedure by which epithelial cells get mesenchymal traits,
Salient function of epithelial-mesenchymal transition (EMT), a procedure by which epithelial cells get mesenchymal...
Er 2000; Gen Mills). So as to make sure that a constant level of sample
Er 2000; Gen Mills). So as to make sure that a constant level of...
Namic response of your x22181 gene could recommend an extremely vital part in sustaining the
Namic response of your x22181 gene could recommend an extremely vital part in sustaining...
Ts (Group I and Group II). Targets in Group I involved more Toll-like Receptor (TLR)
Ts (Group I and Group II). Targets in Group I involved more Toll-like Receptor...
Its neighbor with length r, wherein r is spread based on a stochastic distribution of
Its neighbor with length r, wherein r is spread based on a stochastic distribution...
E salt export pump Multidrug and toxin extrusion transporter Alzheimer's disease Carbamazepine Phenytoin St John's
E salt export pump Multidrug and toxin extrusion transporter Alzheimer’s disease Carbamazepine Phenytoin St...
The other hand, AFT4 is involved in prostaglandinDiscussionScientific Reports |(2021) 11:13465 |https://doi.org/10.1038/NPY Y5 receptor Compound
The other hand, AFT4 is involved in prostaglandinDiscussionScientific Reports |(2021) 11:13465 |https://doi.org/10.1038/NPY Y5 receptor...
To produce a knock-in strain by inserting the T2A-GAL4 cassette into sut1 locus. Around 500
To produce a knock-in strain by inserting the T2A-GAL4 cassette into sut1 locus. Around...
During the late-luteal phase just isn't prevented by hCG, an observation that is not constant
During the late-luteal phase just isn’t prevented by hCG, an observation that is not...
Cement of [125 I]-MIL (24) in mouse striatum and cortex, suggesting an IC50 of about
Cement of -MIL (24) in mouse striatum and cortex, suggesting an IC50 of...
Quine and HydroxychloroquineCQ and HCQ each belong for the 4-aminoquinoline chemical class (Devaux et al.,
Quine and HydroxychloroquineCQ and HCQ each belong for the 4-aminoquinoline chemical class (Devaux et...
Sthuma. 7.11. Anticancer Impact. e methanolic extract of H. indicum roots (ten, 20, 40, 80,
Sthuma. 7.11. Anticancer Impact. e methanolic extract of H. indicum roots (ten, 20, 40,...
Anin hydrate Inophyllum PResidue No.Molecular Diversity (2022) 26:1053076 Fig. 15 Superposition of molecular docking result
Anin hydrate Inophyllum PResidue No.Molecular Diversity (2022) 26:1053076 Fig. 15 Superposition of molecular docking...
Re collected for evaluation, n = 6 in the control group and n = 7
Re collected for evaluation, n = 6 in the control group and n =...
N, Consejo Superior de Investigaciones icas (CSIC), Spain Cienti Reviewed by: Harini Veeraraghavan, Cornell
N, Consejo Superior de Investigaciones icas (CSIC), Spain Cienti Reviewed by: Harini Veeraraghavan, Cornell...
Is definitely an antiplatelet therapy which is broadly applied in pre and post percutaneous (PCI)
Is definitely an antiplatelet therapy which is broadly applied in pre and post percutaneous...
Ty to differentiate into quite a few cell types, which include osteoblasts, chondrocytes, neural cells,
Ty to differentiate into quite a few cell types, which include osteoblasts, chondrocytes, neural...
Gene sets whose functional genetic polymorphisms showed substantial association with HDL, LDL, TC, and TG,
Gene sets whose functional genetic polymorphisms showed substantial association with HDL, LDL, TC, and...
Ntified by densitometric evaluation with the use of ImageStudio software (version five.2). A common curve
Ntified by densitometric evaluation with the use of ImageStudio software (version five.2). A common...
Observed in ASD might lead to a decrease in circulating melatonin mAChR5 MedChemExpress simply because
Observed in ASD might lead to a decrease in circulating melatonin mAChR5 MedChemExpress simply...
Nduced NAFLD mouse model and completely HDAC3 Accession characterized the gene expression, signaling pathways, and
Nduced NAFLD mouse model and completely HDAC3 Accession characterized the gene expression, signaling pathways,...
Strain β-lactam Chemical Biological Activity tolerance to Arabidopsis, indicating the involvement of HDA15 in salt
Strain β-lactam Chemical Biological Activity tolerance to Arabidopsis, indicating the involvement of HDA15 in...
Genes responsible for inflorescence improvement and auxin polar transport to facilitate appropriate auxin distribution in
Genes responsible for inflorescence improvement and auxin polar transport to facilitate appropriate auxin distribution...
Nce Liquid Chromatography-tandem mass spectrometry (UHPLC S/MS) with numerous reaction monitoring (MRM)-based detection in good
Nce Liquid Chromatography-tandem mass spectrometry (UHPLC S/MS) with numerous reaction monitoring (MRM)-based detection in...
N of plant defence by C. purpurea (Additional files two, three and 4). With the
N of plant defence by C. purpurea (Additional files two, three and 4). With...
Parin/warfarin, SD common deviation, VTE venous thromboembolismTable 2 Baseline demographic and clinical traits by BMI
Parin/warfarin, SD common deviation, VTE venous thromboembolismTable 2 Baseline demographic and clinical traits by...
Ability in Mlm and RLM that led both analogs to become selected in in vivo
Ability in Mlm and RLM that led both analogs to become selected in in...
And reported pooled benefits combining each GEO datasets. In ROS, evaluation of cognitive status which
And reported pooled benefits combining each GEO datasets. In ROS, evaluation of cognitive status...
F ctr 1.11 0.02 2.67 0.38 1.53 0.12 1.51 0.02 3.17 0.05 12.96 0.18 0.99
F ctr 1.11 0.02 2.67 0.38 1.53 0.12 1.51 0.02 3.17 0.05 12.96 0.18...
With TMDs, like 50 full-sized ABC transporters. The ratio of ABC proteins to full-sized ABC
With TMDs, like 50 full-sized ABC transporters. The ratio of ABC proteins to full-sized...
Tumorigenesis, abdominal pain, constipation, and, not surprisingly, diarrhea [27,28]. Because of this, GC-C has been
Tumorigenesis, abdominal pain, constipation, and, not surprisingly, diarrhea . Because of this, GC-C has...
Iver RSK2 Biological Activity failure worldwide. So that you can study the hepatoprotective impact of
Iver RSK2 Biological Activity failure worldwide. So that you can study the hepatoprotective impact...
D nuclear magnetic resonance (NMR) spectroscopy, we show that MANF is definitely an ATP binding
D nuclear magnetic resonance (NMR) spectroscopy, we show that MANF is definitely an ATP...
Acid; TCDCA, taurochenodeoxycholic acid; TDCA, taurodeoxycholic acid; CA, cholic acid; UDCA, ursodeoxycholic acid, GCDCA, glycochenodeoxycholic
Acid; TCDCA, taurochenodeoxycholic acid; TDCA, taurodeoxycholic acid; CA, cholic acid; UDCA, ursodeoxycholic acid, GCDCA,...
Ts by 15 hours post APAP when the animals were co-treated with leupeptin (Figure 5C).
Ts by 15 hours post APAP when the animals were co-treated with leupeptin (Figure...
Ogenism and hypoestrogenemia, which are modifications that are accountable for maternal progressive virilization. 17. 46,XX
Ogenism and hypoestrogenemia, which are modifications that are accountable for maternal progressive virilization. 17....
Ts, immunoanalytical methods are the most frequently applied methods for vitamin D measurement in clinical
Ts, immunoanalytical methods are the most frequently applied methods for vitamin D measurement in...
Involved inside the regulation of most biological processes for example cell cycle, apoptosis, muscle differentiation,
Involved inside the regulation of most biological processes for example cell cycle, apoptosis, muscle...
Ed postprandial concentrations of milk protein-derived amino acids that activate mTORC1 [59,71,72].Biomolecules 2021, 11,4 ofTable
Ed postprandial concentrations of milk protein-derived amino acids that activate mTORC1 .Biomolecules 2021, 11,4...
Chidonic acid All round OC Overall OC 25509 1520 311 720 Yuan et al. (45),
Chidonic acid All round OC Overall OC 25509 1520 311 720 Yuan et al....
And nearby anesthetic agent remedy, which delivers an epinephrine dose of 0.450 J Pediatr Pharmacol
And nearby anesthetic agent remedy, which delivers an epinephrine dose of 0.450 J Pediatr...
Y price 0.05 and a nominal p-value 0.05 was viewed as statistically significant.Immune
Y price 0.05 and a nominal p-value 0.05 was viewed as statistically significant.Immune Infiltration...
Not significant. Consequently, largescale research are needed for further evaluation and to validate these early
Not significant. Consequently, largescale research are needed for further evaluation and to validate these...
Performing the final biosynthetic step on polyene. These four enzymes catalyze different chemical reactions: hydroxylation
Performing the final biosynthetic step on polyene. These four enzymes catalyze different chemical reactions:...
Gy Division) in the University of Granada. The three cell lines have been maintained with
Gy Division) in the University of Granada. The three cell lines have been maintained...
Ivity (Sanders et al., 2020). It primarily shows anti-influenza virus activity but additionally has been
Ivity (Sanders et al., 2020). It primarily shows anti-influenza virus activity but additionally has...
Y-FAs. cytochrome P450 (CYP)-soluble epoxide hydrolase U test. N.S., non-significant. dihydroxy-FAs. P values have been
Y-FAs. cytochrome P450 (CYP)-soluble epoxide hydrolase U test. N.S., non-significant. dihydroxy-FAs. P values have...
Y41,42. Current studies have suggested that CYP46A1 plays a key part inside the preservation of
Y41,42. Current studies have suggested that CYP46A1 plays a key part inside the preservation...
Ating element 1 receptor (c-Fms). When this protein is inhibited, bone absorption deficiency occurs, that
Ating element 1 receptor (c-Fms). When this protein is inhibited, bone absorption deficiency occurs,...
Ter through an incremental test [65]. We realize that endurance workout lasts greater than an
Ter through an incremental test . We realize that endurance workout lasts greater than...
N. Cells have been seeded on elastic silicone membranes and subjected to cyclic uniaxial stretching
N. Cells have been seeded on elastic silicone membranes and subjected to cyclic uniaxial...
Aracteristics that show a powerful correlation with clinical events. The frequent selection strategies could be
Aracteristics that show a powerful correlation with clinical events. The frequent selection strategies could...
Viously. Nevertheless, a not too long ago created sequencing system using targeted NGS performed on
Viously. Nevertheless, a not too long ago created sequencing system using targeted NGS performed...
Inogens may well alter flow-metabolism coupling in brain. As a result, there is certainly an
Inogens may well alter flow-metabolism coupling in brain. As a result, there is certainly...
Liver cells by mitochondria [117]. The primary roles of NADH and NADPH in cell metabolism
Liver cells by mitochondria . The primary roles of NADH and NADPH in cell...
From CHB to P2X7 Receptor MedChemExpress cirrhosis and HCCThe clinical pathway of most HBV-related HCC
From CHB to P2X7 Receptor MedChemExpress cirrhosis and HCCThe clinical pathway of most HBV-related...
Rom neuroepithelium on the optic cup, form six distinct neuronal cell types and one particular
Rom neuroepithelium on the optic cup, form six distinct neuronal cell types and one...
Imilarity involving hepatocytes and also the two cell kinds. We then applied CTS gene clusters
Imilarity involving hepatocytes and also the two cell kinds. We then applied CTS gene...
Are infections, most notably viruses. Regardless of the somewhat higher frequency of this issue, epidemiologic
Are infections, most notably viruses. Regardless of the somewhat higher frequency of this issue,...
St that some NPs may possibly have protective effects on sperm cells [91], other reports
St that some NPs may possibly have protective effects on sperm cells , other...
Lysis allowed identification of P-I rich, P-II wealthy or both P-I and P-II wealthy genotypes.
Lysis allowed identification of P-I rich, P-II wealthy or both P-I and P-II wealthy...
Lation in the ET biosynthetic genes ACS and ACO had been also observed by [59,
Lation in the ET biosynthetic genes ACS and ACO had been also observed by...
Genes, such as PERK and ATF4. Another ER tension sensor PERK phosphorylates eIF-2 for the
Genes, such as PERK and ATF4. Another ER tension sensor PERK phosphorylates eIF-2 for...
Ft and proper borders together with the primer pair MI938_orf1_LB_fw/MI939_orf1_LB_rv and MI940_orf1_RB_fw/MI941_orf1_RB_rv, respectively. The left
Ft and proper borders together with the primer pair MI938_orf1_LB_fw/MI939_orf1_LB_rv and MI940_orf1_RB_fw/MI941_orf1_RB_rv, respectively. The...
Is with mFPS144 was necessary due to the fact yeast FPP synthase, ERG20, was knocked-out
Is with mFPS144 was necessary due to the fact yeast FPP synthase, ERG20, was...
Lity in these regions is reflected by the crosslinking but not apparent in the structural
Lity in these regions is reflected by the crosslinking but not apparent in the...
Lation with the ET biosynthetic genes ACS and ACO have been also observed by [59,
Lation with the ET biosynthetic genes ACS and ACO have been also observed by...
Toxicity, heart failure, and several non-reversible problems which have been previously reported [45,50]. The results
Toxicity, heart failure, and several non-reversible problems which have been previously reported . The...
Of 0.five m M before each medium change. Adipogenesis was induced in postconfluence cultures by
Of 0.five m M before each medium change. Adipogenesis was induced in postconfluence cultures...
Studies have focused around the metabolic alterations induced or regulated by ferroptosis in tumors. Hence,
Studies have focused around the metabolic alterations induced or regulated by ferroptosis in tumors....
E and transplanted in to the yolk sac of wild-type AB strain zebrafish 2 days
E and transplanted in to the yolk sac of wild-type AB strain zebrafish 2...
Lation from the ET biosynthetic genes ACS and ACO had been also observed by [59,
Lation from the ET biosynthetic genes ACS and ACO had been also observed by...
Nied by adverse reactions such as psychosis and muscle weakness. Furthermore, steroids are prothrombotic, as
Nied by adverse reactions such as psychosis and muscle weakness. Furthermore, steroids are prothrombotic,...
Mammals and consequent impacts of toxicity26 fewer pups had been created at oiled web-sites
Mammals and consequent impacts of toxicity26 fewer pups had been created at oiled web-sites...
Andthe SARS-CoV-2from Codium fragile, against against SARS-CoV-2 virus infection (using siphonaxanthin pseudovirus) in HEK293/ SARS-CoV-2This
Andthe SARS-CoV-2from Codium fragile, against against SARS-CoV-2 virus infection (using siphonaxanthin pseudovirus) in HEK293/...
Nt who died from Enolase Formulation COVID-19 showed moderate microvesicular steatosis and mild lobular and
Nt who died from Enolase Formulation COVID-19 showed moderate microvesicular steatosis and mild lobular...
Tion price by the downregulation of Ki6 (113). In relation together with the effect of
Tion price by the downregulation of Ki6 (113). In relation together with the effect...
Olic activities present inside the liver. Biochemical cues may also be made use of in
Olic activities present inside the liver. Biochemical cues may also be made use of...
D Central, Scopus, and Google Scholar databases of articles had been collected, and abstracts were
D Central, Scopus, and Google Scholar databases of articles had been collected, and abstracts...
N this study, except for the T6P synthase homolog TPS (Unigene0013555) that was downregulated in
N this study, except for the T6P synthase homolog TPS (Unigene0013555) that was downregulated...
Neric conjugations and 21 days). E. 250 rpm), Difco LB agar and DEF-15) and at
Neric conjugations and 21 days). E. 250 rpm), Difco LB agar and DEF-15) and...
Targeting programmed cell death protein four (PDCD4) in exosome-treated CCs and therefore, it alleviated PCOS
Targeting programmed cell death protein four (PDCD4) in exosome-treated CCs and therefore, it alleviated...
Lity in these regions is reflected by the crosslinking but not apparent inside the structural
Lity in these regions is reflected by the crosslinking but not apparent inside the...
And symbionts as well as play roles in responses to toxic states with important pleiotropic
And symbionts as well as play roles in responses to toxic states with important...
Compared with Col-0 (Supplementary Figures 1C,D). Under salt situations, the percentage of germinated HDA15 OE
Compared with Col-0 (Supplementary Figures 1C,D). Under salt situations, the percentage of germinated HDA15...
St that some NPs could have protective effects on sperm cells [91], other reports recommend
St that some NPs could have protective effects on sperm cells , other reports...
Cortex). For cholesterol catabolism (enzymatic), we observed considerably altered gene expression (FDR-adjusted P value 0.05)
Cortex). For cholesterol catabolism (enzymatic), we observed considerably altered gene expression (FDR-adjusted P value...
Rates have been larger for IBX in comparison to FLU, respectively [113]. In two phase
Rates have been larger for IBX in comparison to FLU, respectively . In two...
S 3 ), 36 h (99.4 0.six ), and 24 h (88.three 8 ), respectively.
S 3 ), 36 h (99.4 0.six ), and 24 h (88.three 8 ),...
E and transplanted in to the yolk sac of wild-type AB strain zebrafish 2 days
E and transplanted in to the yolk sac of wild-type AB strain zebrafish 2...
Drastically affected lidocaine elimination and was properly accounted for in kinetic analysis. Lidocaine elimination and
Drastically affected lidocaine elimination and was properly accounted for in kinetic analysis. Lidocaine elimination...
Nscriptome to discover biological functions. Conclusions: Right here, we present the first systematic analysis of
Nscriptome to discover biological functions. Conclusions: Right here, we present the first systematic analysis...
Lystyrene may very well be totally oxidized oxidized pretty much zero. In 2019, Ward et
Lystyrene may very well be totally oxidized oxidized pretty much zero. In 2019, Ward...
Uct m/z at 681.16 Da. ECG - amino acid letter code of GSH. Peaks around
Uct m/z at 681.16 Da. ECG – amino acid letter code of GSH. Peaks...
Optimistic associations HIV-1 Activator Purity & Documentation amongst alcohol consumption and cancers of your mouth
Optimistic associations HIV-1 Activator Purity & Documentation amongst alcohol consumption and cancers of your...
Re quite frequent generally population, and malignant carcinomas with dismal prognosis is normally unfeasible. Even
Re quite frequent generally population, and malignant carcinomas with dismal prognosis is normally unfeasible....
Abundant catechin in green tea, and it has exerted potent antioxidant activity in vitro and
Abundant catechin in green tea, and it has exerted potent antioxidant activity in vitro...
From the artemisinin precursor amorphadiene19 and n-butanol20 as examples. Alternatively, synthetic circuits is usually built
From the artemisinin precursor amorphadiene19 and n-butanol20 as examples. Alternatively, synthetic circuits is usually...
Data a priori. As a method to circumvent this limitation, information may be also analyzed
Data a priori. As a method to circumvent this limitation, information may be also...
N, Consejo Superior de Investigaciones icas (CSIC), Spain Cienti Reviewed by: Harini Veeraraghavan, Cornell
N, Consejo Superior de Investigaciones icas (CSIC), Spain Cienti Reviewed by: Harini Veeraraghavan, Cornell...
Ng adenoma (APA), while they may be incredibly low in regular adults. CYP11A1: cytochrome P450
Ng adenoma (APA), while they may be incredibly low in regular adults. CYP11A1: cytochrome...
Henotype, that is now more typical because of secondary ADT, are also open to speculation.
Henotype, that is now more typical because of secondary ADT, are also open to...
D the high SI 373 for the formation of hydrogen bond with Arg120 (among the
D the high SI 373 for the formation of hydrogen bond with Arg120 (among...
Analysis interactions involving sex and some hormones regarding glycemic traits (on line supplemental table 1),
Analysis interactions involving sex and some hormones regarding glycemic traits (on line supplemental table...
Recognized to be constitutively activated in numerous varieties of hematopoietic and strong tumors [124]. Canonical
Recognized to be constitutively activated in numerous varieties of hematopoietic and strong tumors ....
Ivo efficacy, it really is an ideal lead compound for additional development of potent and
Ivo efficacy, it really is an ideal lead compound for additional development of potent...
Rophotometrically as shown in our study [29,30]. Glutathione peroxidase (GPX) activity was detected by a
Rophotometrically as shown in our study . Glutathione peroxidase (GPX) activity was detected by...
A subset of 253 isolates was re-evaluated with two technical and 3 biological repetitions, as
A subset of 253 isolates was re-evaluated with two technical and 3 biological repetitions,...
Ract. For the inhibitory activity analysis, C2 showed 13.2 and 55.eight of residual
Ract. For the inhibitory activity analysis, C2 showed 13.2 and 55.eight of residual activity...
Grammes. To access the genes for resistance and incorporate them into well-adapted varieties, conventional breeding
Grammes. To access the genes for resistance and incorporate them into well-adapted varieties, conventional...
Onor cell engraftment, division and differentiation persist to recapitulate such lengthy periods of standard development.
Onor cell engraftment, division and differentiation persist to recapitulate such lengthy periods of standard...
D at first before planning a long-term method, in particular just before endurance racing or
D at first before planning a long-term method, in particular just before endurance racing...
Osed for the addition of 15-keto-PGE2 to signal transducer and activator of transcription 3 (STAT3)
Osed for the addition of 15-keto-PGE2 to signal transducer and activator of transcription 3...
Processes. We speculate that the components involved in cytokinin regulating auxin gradient Adenosine A1 receptor
Processes. We speculate that the components involved in cytokinin regulating auxin gradient Adenosine A1...
Passes by means of the cell and mitochondrial membrane), pregnenolone (a substrate of 3-HSD), androstenedione
Passes by means of the cell and mitochondrial membrane), pregnenolone (a substrate of 3-HSD),...
Inases (LecRK), Mitogen-activated kinase (MAPK), serine/threonine kinases (STKs)); c Antifungal proteins ((functional categories from prime
Inases (LecRK), Mitogen-activated kinase (MAPK), serine/threonine kinases (STKs)); c Antifungal proteins ((functional categories from...
Ever been so critical because it can inform on the adaptive potential to resist the
Ever been so critical because it can inform on the adaptive potential to resist...
Rved in these taxa, an identification scheme is presented for fusarioid genera in the Nectriaceae
Rved in these taxa, an identification scheme is presented for fusarioid genera in the...
Ficient spiral-artery remodeling mediated by trophoblast invasion, a extensive prospect for the pathogenicity from the
Ficient spiral-artery remodeling mediated by trophoblast invasion, a extensive prospect for the pathogenicity from...
N metabolite levels and CERAD and Braak scores independent of illness status (i.e., illness status
N metabolite levels and CERAD and Braak scores independent of illness status (i.e., illness...
Es 2, three and 4). Annotation of those DEG indicated enrichment to get a variety
Es 2, three and 4). Annotation of those DEG indicated enrichment to get a...
Eractions were determined utilizing p value 0.01. 2.11. Neural Network-Based Deep Mastering Framework and
Eractions were determined utilizing p value 0.01. 2.11. Neural Network-Based Deep Mastering Framework and...
Ogy and Agricultural Zoology, Division of Agriculture, Crop Production and Rural Environment, University of Thessaly,
Ogy and Agricultural Zoology, Division of Agriculture, Crop Production and Rural Environment, University of...
Rom microarray information and Log2 fold CXCR1 Antagonist manufacturer modify values from RQ-PCR data are
Rom microarray information and Log2 fold CXCR1 Antagonist manufacturer modify values from RQ-PCR data...
Rget Network of TA Genes and MicroRNA in Chinese HickoryMicroRNA is really a incredibly essential
Rget Network of TA Genes and MicroRNA in Chinese HickoryMicroRNA is really a incredibly...
Hypertrophy as observed in the normalized values of the entire heart marked bilateral cardiac hypertrophy
Hypertrophy as observed in the normalized values of the entire heart marked bilateral cardiac...
Einhardtii in which C18:36,9,12 and C18:46,9,12,15 are replaced by C18:35,9,12 and C18:45,9,12,15, respectively [141]. The
Einhardtii in which C18:36,9,12 and C18:46,9,12,15 are replaced by C18:35,9,12 and C18:45,9,12,15, respectively ....
Detectable levels of ACE2 and the TMPRSS2 protease, a) the alveolar epithelial cells supported virion
Detectable levels of ACE2 and the TMPRSS2 protease, a) the alveolar epithelial cells supported...
Uld be deemed as a great green option not merely in food and nutraceutical business
Uld be deemed as a great green option not merely in food and nutraceutical...
Uncovered a devoted nonribosomal peptide synthase (NRPS) and various tailoring enzymes, which includes the aforementioned
Uncovered a devoted nonribosomal peptide synthase (NRPS) and various tailoring enzymes, which includes the...
Nces, Universitdegli two. Components and Procedures Studi di Milano, San Paolo Hospital, Milan, Italy. We
Nces, Universitdegli two. Components and Procedures Studi di Milano, San Paolo Hospital, Milan, Italy....
Mples have been obtained in the study of Seralini et al. [10], which was retracted
Mples have been obtained in the study of Seralini et al. , which was...
Human breast cancer cell line with estrogen, androgen, progesterone, and glucocorticoid receptors, and (three) MCF-10A
Human breast cancer cell line with estrogen, androgen, progesterone, and glucocorticoid receptors, and (three)...
F remedy discontinuations have been on account of low-grade toxicities [35]. In 2020, Chamberlain et
F remedy discontinuations have been on account of low-grade toxicities . In 2020, Chamberlain...
Alterations in brain tissue concentrations of nonenzymatically generated oxysterols in AD (Fig. 2d). These integrated
Alterations in brain tissue concentrations of nonenzymatically generated oxysterols in AD (Fig. 2d). These...
Tegrative modeling can contribute a good deal to Cereblon manufacturer solving this issue. We propose
Tegrative modeling can contribute a good deal to Cereblon manufacturer solving this issue. We...
Or rounding errors. b As reported in original study unless otherwise noted. No main variations
Or rounding errors. b As reported in original study unless otherwise noted. No main...
Sity Wellness Centre, Montreal, Canada; 4Department of Molecular Genetics, University of Toronto, Toronto, Canada; 5Department
Sity Wellness Centre, Montreal, Canada; 4Department of Molecular Genetics, University of Toronto, Toronto, Canada;...
Muscle, and C2C12 myoblasts had been cultured in GM. Flk-1 and Flt-1 transcripts had been
Muscle, and C2C12 myoblasts had been cultured in GM. Flk-1 and Flt-1 transcripts had...
Ith O2- damage 600. This hydrosoluble molecule can diffuse across cells and might reach distant
Ith O2- damage 600. This hydrosoluble molecule can diffuse across cells and might reach...
Are activated by luteal PDGF-signaling (Kano et al., 2005; Robinson et al., 2009; Woad et
Are activated by luteal PDGF-signaling (Kano et al., 2005; Robinson et al., 2009; Woad...
Ns amongst fusion companion identity and lineage outcome, that added components are involved, which includes
Ns amongst fusion companion identity and lineage outcome, that added components are involved, which...
N the context of regulation on the meiotic arrest of oocytes in Graafian follicles. Natriuretic
N the context of regulation on the meiotic arrest of oocytes in Graafian follicles....
Ns appeared to be eliminated quicker than other GFP cell populations in injured tissue. Silencing
Ns appeared to be eliminated quicker than other GFP cell populations in injured tissue....
Per plate, it can be essential that each of the actions in the analytical procedure
Per plate, it can be essential that each of the actions in the analytical...
Ing nuclear factor- (NF-) B and activator protein 1, which facilitate the modulation of gene
Ing nuclear factor- (NF-) B and activator protein 1, which facilitate the modulation of...
Ion in particular regionstoo close to the permanent tooth to come (Fig 1). Permanent tooth
Ion in particular regionstoo close to the permanent tooth to come (Fig 1). Permanent...
Zation experiments working with Indo-1. This manuscript will concentrate on making use of Indo-1 AM
Zation experiments working with Indo-1. This manuscript will concentrate on making use of Indo-1...
P1 gene, that is the second coding exon, applying Cre/lox-mediated DNA recombination [15]. Embryonic stem
P1 gene, that is the second coding exon, applying Cre/lox-mediated DNA recombination . Embryonic...
Tosis and cytoarchitectura l remodeling (Kim, Kim, Ko, 2010). Once chemokines tether for
Tosis and cytoarchitectura l remodeling (Kim, Kim, Ko, 2010). Once chemokines tether for the...
Ld be regarded, such as optimistic skew that tends to get minimized with log-amplification as
Ld be regarded, such as optimistic skew that tends to get minimized with log-amplification...
T) and Latrunculin B or Cytochalasin D treated cells are shown in dotted lines and
T) and Latrunculin B or Cytochalasin D treated cells are shown in dotted lines...
Ature and pre-warm Target Probe diluent to 40 in the incubator. 15.Aspirate the supernatant
Ature and pre-warm Target Probe diluent to 40 in the incubator. 15.Aspirate the supernatant...
Ment Center (Frederick, MD, USA). Actinomycin D (ActD), Camptothecin (CPT) and Etoposide (ETO) had been
Ment Center (Frederick, MD, USA). Actinomycin D (ActD), Camptothecin (CPT) and Etoposide (ETO) had...
Seem to JNK Purity & Documentation become essential regulators of context dependent proliferation manage. Accessible
Seem to JNK Purity & Documentation become essential regulators of context dependent proliferation manage....
R to determine the cell style of CXCR-positive cells, serial sectioning was carried out and
R to determine the cell style of CXCR-positive cells, serial sectioning was carried out...
Ical contraindications, written informed consent obtained). Sufferers also applied erythropoietin-stimulating agents, iron supplements, and water-soluble
Ical contraindications, written informed consent obtained). Sufferers also applied erythropoietin-stimulating agents, iron supplements, and...
Ld regulate the production and release from the CGF development components, show stem capabilities and
Ld regulate the production and release from the CGF development components, show stem capabilities...
Dividual antigen-specific CTLs by movement cytometry. This process may be helpful to complement the ex
Dividual antigen-specific CTLs by movement cytometry. This process may be helpful to complement the...
As been reported that inside a rabbit model of hindlimb ischemia, VEGF mRNA and protein
As been reported that inside a rabbit model of hindlimb ischemia, VEGF mRNA and...
Ereas LIF led to a enormous improve, thrice as a great deal as for FCS.
Ereas LIF led to a enormous improve, thrice as a great deal as for...
Fibroblasts and the time point in the measurements, for e.g. might have to have to
Fibroblasts and the time point in the measurements, for e.g. might have to have...
Lar weight of PEG)28 daysbone regeneration[93]BMP-7 weeks in vitro; 2 weeks in vivo 1 month
Lar weight of PEG)28 daysbone regenerationBMP-7 weeks in vitro; 2 weeks in vivo 1...
Genous VEGF decreased the amount of apoptotic C2C12 cells throughout differentiation. Hypoxia improved VEGF secretion
Genous VEGF decreased the amount of apoptotic C2C12 cells throughout differentiation. Hypoxia improved VEGF...
That has absorption/emission maxima of 511/533 nm. When utilized along with the SYTOXAADvancedTM Dead
That has absorption/emission maxima of 511/533 nm. When utilized along with the SYTOXAADvancedTM Dead...
Onse to oxidative pressure, our laboratory studied the Brd Inhibitor web function of HN in
Onse to oxidative pressure, our laboratory studied the Brd Inhibitor web function of HN...
Nother study, on the contrary, thrombin induced prominent circumferential localization of actin fibers, improved MLC
Nother study, on the contrary, thrombin induced prominent circumferential localization of actin fibers, improved...
After arrival, these cells start differentiating into a myofibroblast-like phenotype ErbB3/HER3 drug beneath the influence
After arrival, these cells start differentiating into a myofibroblast-like phenotype ErbB3/HER3 drug beneath the...
Ovide data suggesting heterogeneity in single-cell PDGFRβ Molecular Weight behaviour with regards to EV secretion.Introduction:
Ovide data suggesting heterogeneity in single-cell PDGFRβ Molecular Weight behaviour with regards to EV...
Esence of at the least 2 from the following criteria: uterine tenderness, malodorous vaginal discharge,
Esence of at the least 2 from the following criteria: uterine tenderness, malodorous vaginal...
Phils have been crucial, whereas within the chemotherapy study, IFN-gsecreting CD8 + T cells have
Phils have been crucial, whereas within the chemotherapy study, IFN-gsecreting CD8 + T cells...
As PVR. [27] Briggs et al. searched the presence of HGF in PVR membranes, inside
As PVR. Briggs et al. searched the presence of HGF in PVR membranes,...
Web-site into tissue-specific cell types [124]. Possible difficulties when using BM-MSCs for tissue repair incorporate
Web-site into tissue-specific cell types . Possible difficulties when using BM-MSCs for tissue repair...
Hepatocytes and inside the plasma; it exists in an insoluble kind synthesized by fibroblasts, epithelial
Hepatocytes and inside the plasma; it exists in an insoluble kind synthesized by fibroblasts,...
Ll retained. Furthermore, in selected disorders, Rh123 binding to mitochondria is usually independent of mitochondrial
Ll retained. Furthermore, in selected disorders, Rh123 binding to mitochondria is usually independent of...
Nchopulmonary dysplasia (BPD). This injury is usually reversed applying Postnatal intratracheal adenovirus-mediated VEGF gene therapy
Nchopulmonary dysplasia (BPD). This injury is usually reversed applying Postnatal intratracheal adenovirus-mediated VEGF gene...
Disulfide bonds11. The human LECT2 gene is mapped to chromosome 5q31.1-q32, a cluster harboring many
Disulfide bonds11. The human LECT2 gene is mapped to chromosome 5q31.1-q32, a cluster harboring...
Nce (AFC) are intact. In patients with ARDS, in contrast, the MMP-7 site alveolar edema
Nce (AFC) are intact. In patients with ARDS, in contrast, the MMP-7 site alveolar...
Contrast, a study in chick revealed that VEGFR2 and Nrp1 are expressed in cranial NCCs
Contrast, a study in chick revealed that VEGFR2 and Nrp1 are expressed in cranial...
Ase. RT reaction was carried out in a thermal cycler for 10 min at 25
Ase. RT reaction was carried out in a thermal cycler for 10 min at...
Ion of host cells to release EVs to transport their own genetic material or proteins,
Ion of host cells to release EVs to transport their own genetic material or...
Orylates a substrate; JH2 can be a PK domain. JH2 is structurally equivalent towards the
Orylates a substrate; JH2 can be a PK domain. JH2 is structurally equivalent towards...
Ctivated and may be detected by movement cytometry 568. Therefore, fluorescence intensities correlate with CTL-dependent
Ctivated and may be detected by movement cytometry 568. Therefore, fluorescence intensities correlate with...
T the cysteine oxidation and disulfide bond formation promoted the aggregation of TDP-43 (Cohen et
T the cysteine oxidation and disulfide bond formation promoted the aggregation of TDP-43 (Cohen...
Ter onset. ALS has a distinctive presentation with pure motor involvement presenting with muscle weakness
Ter onset. ALS has a distinctive presentation with pure motor involvement presenting with muscle...
Tants that are classified as mutants with GOF activity7,11,34 (i.e. positions R245, R248, R175, R273,
Tants that are classified as mutants with GOF activity7,11,34 (i.e. positions R245, R248, R175,...
Defining the BMP-binding epitope (Figure 6A). With no these residues, it will be anticipated that
Defining the BMP-binding epitope (Figure 6A). With no these residues, it will be anticipated...
D as essential. Popliteal lymph nodes from the immunized mice have been harvested around day
D as essential. Popliteal lymph nodes from the immunized mice have been harvested around...
Ed from SRL computer systems and file servers. In clinical environment, there can be added
Ed from SRL computer systems and file servers. In clinical environment, there can be...
Ive controls is often integrated. As an example, we applied ammonium peroxodisulfate (APS; 0.001.1), a
Ive controls is often integrated. As an example, we applied ammonium peroxodisulfate (APS; 0.001.1),...
Y IL-1 necessary a disintegrin and metalloproteinase 17 (ADAM17)-dependent shedding of the ligand neuregulin-1 (NRG-1).
Y IL-1 necessary a disintegrin and metalloproteinase 17 (ADAM17)-dependent shedding of the ligand neuregulin-1...
TorLowercase appellation applied by convention simply because a functional response in native cells or tissues
TorLowercase appellation applied by convention simply because a functional response in native cells or...
UMig species was 78 amino acids in length. When this mGluR5 Modulator Biological Activity rHuMig
UMig species was 78 amino acids in length. When this mGluR5 Modulator Biological Activity...
D at the least three times, a IL-5 Antagonist Species representative experiment is shown. eGFP,
D at the least three times, a IL-5 Antagonist Species representative experiment is shown....
Ion, proliferation and apoptosis in response to various concentrations of carboplatin (0-100 ) have been
Ion, proliferation and apoptosis in response to various concentrations of carboplatin (0-100 ) have...
D monocytes like a useful illustration. The approaches we use for cell fixation and permeabilization
D monocytes like a useful illustration. The approaches we use for cell fixation and...
M Biosciences, Piscataway, NJ). Evans blue dye assay for pulmonary vascular permeability Pulmonary vascular permeability
M Biosciences, Piscataway, NJ). Evans blue dye assay for pulmonary vascular permeability Pulmonary vascular...
Que layer. Centrifuge at 1800 g for 25 min, at area temperature. Crucial: set centrifuge
Que layer. Centrifuge at 1800 g for 25 min, at area temperature. Crucial: set...
Erentiation and that this was resulting from enhanced IL-4 production (20). When mice lacking Ndfip1
Erentiation and that this was resulting from enhanced IL-4 production (20). When mice lacking...
Ment Center (Frederick, MD, USA). Actinomycin D (ActD), Camptothecin (CPT) and Etoposide (ETO) had been
Ment Center (Frederick, MD, USA). Actinomycin D (ActD), Camptothecin (CPT) and Etoposide (ETO) had...
Map of the expression of 'defense response' genes in wild-type and in Tgm1epidermis. Every single
Map of the expression of “defense response” genes in wild-type and in Tgm1epidermis. Every...
Not describe any strategies made use of to conceal the random sequence, so we assessed
Not describe any strategies made use of to conceal the random sequence, so we...
Gineering scaffolding, biotechnology, agriculture, and environmental protection applications, on account of its good adsorption, drug
Gineering scaffolding, biotechnology, agriculture, and environmental protection applications, on account of its good adsorption,...
Formed cells [37]. This atmosphere composed of tumor cells, endothelial cells, immune cells, fibroblasts, macrophages,
Formed cells . This atmosphere composed of tumor cells, endothelial cells, immune cells, fibroblasts,...
Genous VEGF decreased the number of apoptotic C2C12 cells through differentiation. Hypoxia increased VEGF secretion
Genous VEGF decreased the number of apoptotic C2C12 cells through differentiation. Hypoxia increased VEGF...
Ll retained. On top of that, in selected ailments, Rh123 binding to mitochondria may be
Ll retained. On top of that, in selected ailments, Rh123 binding to mitochondria may...
Ra et al., 2014), but the effects of such a treatment on typical BBB restoration
Ra et al., 2014), but the effects of such a treatment on typical BBB...
Ally verified [37]. Stabilization with the ephrin GH loop having a disulfide bond could represent
Ally verified . Stabilization with the ephrin GH loop having a disulfide bond could...
Ated expression of Jagged- and Notch-proteins within the periportal regions at day 4 following D3
Ated expression of Jagged- and Notch-proteins within the periportal regions at day 4 following...
Knockdown, blocks Cripto-1 effects on Activin A, Activin B, TGF-1 and Nodal signaling and also
Knockdown, blocks Cripto-1 effects on Activin A, Activin B, TGF-1 and Nodal signaling and...
Lect developmentally competent eggs and viable embryos [311]. The major dilemma would be the unknown
Lect developmentally competent eggs and viable embryos . The major dilemma would be the...
Ive controls can be included. For instance, we made use of ammonium peroxodisulfate (APS; 0.001.one),
Ive controls can be included. For instance, we made use of ammonium peroxodisulfate (APS;...
Ration of endosomal and lysosomal organelles fraction was obtained working with this technique. We identified
Ration of endosomal and lysosomal organelles fraction was obtained working with this technique. We...
Ipocyte markers which include Ucp1 and 3-adrenergic receptor in comparison with key brown adipocytes derived
Ipocyte markers which include Ucp1 and 3-adrenergic receptor in comparison with key brown adipocytes...
S of IL-10. This impact is exclusive to CD2 signaling because it is not really
S of IL-10. This impact is exclusive to CD2 signaling because it is not...
Skill of Treg to suppress autoimmune processes and allograft rejection is dependent around the expression
Skill of Treg to suppress autoimmune processes and allograft rejection is dependent around the...
Her curiosity, one can assign them in a so referred to as 'dump channel' with
Her curiosity, one can assign them in a so referred to as “dump channel”...
L. [168] also that increasedincreased glial fibrillary acidic a marker of astrocyte activity, was suppressed
L. also that increasedincreased glial fibrillary acidic a marker of astrocyte activity, was...
Lls had been incubated with 5 M MitoSOXTM reagent dissolved in DMSO, following the manufacturer's
Lls had been incubated with 5 M MitoSOXTM reagent dissolved in DMSO, following the...
HQSOX1b and hPDI, both eukaryotic thiol/ disulfide oxidoreductases. We cloned hQSOX1b and hPDI right into
HQSOX1b and hPDI, both eukaryotic thiol/ disulfide oxidoreductases. We cloned hQSOX1b and hPDI right...
O Albania Department of Neurosciences, Mario Negri Institute for Pharmacological Research IRCCS, Milan, Italy; bMolecular
O Albania Department of Neurosciences, Mario Negri Institute for Pharmacological Research IRCCS, Milan, Italy;...
Py soon after high-pressure freezing. Final results: Our data show that melanoma cells secrete subpopulations
Py soon after high-pressure freezing. Final results: Our data show that melanoma cells secrete...
Ature and pre-warm Target Probe diluent to 40 during the incubator. 15.Aspirate the 5-HT2
Ature and pre-warm Target Probe diluent to 40 during the incubator. 15.Aspirate the 5-HT2...
Ariables are expressed as signifies SEM. Comparisons in between two groups had been analysed by
Ariables are expressed as signifies SEM. Comparisons in between two groups had been analysed...
Tivators of STAT5 include STAT5a and STAT5b. The similarity of STAT5a and STAT5b at the
Tivators of STAT5 include STAT5a and STAT5b. The similarity of STAT5a and STAT5b at...
Been delivered in CMC include TGF- loved ones members, such as BMP-2 utilised for bone
Been delivered in CMC include TGF- loved ones members, such as BMP-2 utilised for...
Ion stage, function and cellular spot. While in the last decades movement cytometry proved itself
Ion stage, function and cellular spot. While in the last decades movement cytometry proved...
Ge20 of total CD4+ T cells in infants (i.e., under two years) to
Ge20 of total CD4+ T cells in infants (i.e., under two years) to 5...
H could be subdivided into IgA1+ and IgA2+ B cells. Here, we employed an Ab
H could be subdivided into IgA1+ and IgA2+ B cells. Here, we employed an...
Cancers. Certain mutp53 proteins get oncogenic functions (GOF) distinct from the tumour suppressor activity in
Cancers. Certain mutp53 proteins get oncogenic functions (GOF) distinct from the tumour suppressor activity...
Discrepancies among preparation protocols plus the presence of cells (platelets, leuxcocytes) which can evoke cellular
Discrepancies among preparation protocols plus the presence of cells (platelets, leuxcocytes) which can evoke...
Ells reminiscent of T cells, B cells, and T cells respectively, with VLRB
Ells reminiscent of T cells, B cells, and T cells respectively, with VLRB becoming...
Tochemical reaction in the cytoplasm and total SMC have been counted applying a tablet measure
Tochemical reaction in the cytoplasm and total SMC have been counted applying a tablet...
Ells might be sorted as CD44int/lowCD62Lhi cells. CD25 could be integrated as well to exclude
Ells might be sorted as CD44int/lowCD62Lhi cells. CD25 could be integrated as well to...
Etching similarly unfolds talin and also other mechanosensitive proteins, as a result exposing cryptic binding
Etching similarly unfolds talin and also other mechanosensitive proteins, as a result exposing cryptic...
Ed with the Slit2fl/fl (Slit2 gene will get deleted not SLIT2 protein) mice to generate
Ed with the Slit2fl/fl (Slit2 gene will get deleted not SLIT2 protein) mice to...
On of sub-population sizes and properties by gatingAuthor Manuscript Writer Manuscript Author Manuscript Writer Manuscript1.three.one
On of sub-population sizes and properties by gatingAuthor Manuscript Writer Manuscript Author Manuscript Writer...
F Ccr2, Trem2 (stimulates production of cytokines and chemokines in macrophages), IL10ra (receptor of IL10),
F Ccr2, Trem2 (stimulates production of cytokines and chemokines in macrophages), IL10ra (receptor of...
Drenal Medullary RegulationThe adrenal gland is actually a crucial organ involved inside the physiological adaptation
Drenal Medullary RegulationThe adrenal gland is actually a crucial organ involved inside the physiological...
Of samples nevertheless it has higher significance for the study of different physique TLR7 Agonist
Of samples nevertheless it has higher significance for the study of different physique TLR7...
Ents with sepsis. Therapies directed at melatonin signaling may possibly be potentially beneficial inside the
Ents with sepsis. Therapies directed at melatonin signaling may possibly be potentially beneficial inside...
H caveolae in untreated cells exactly where selected because the target group for the TWEAK
H caveolae in untreated cells exactly where selected because the target group for the...
Orimoto et al. [85] implicated that Sulf2 can promote angiogenesis in breast cancer. These angiogenesis
Orimoto et al. implicated that Sulf2 can promote angiogenesis in breast cancer. These...
Are studies that show the part of myokines in the LFA-3/CD58 Proteins manufacturer common metabolism
Are studies that show the part of myokines in the LFA-3/CD58 Proteins manufacturer common...
Ing fibers exhibited diffuse Flk-1 and Flt-1 labeling (Figure 2D). In mature fibers, at the
Ing fibers exhibited diffuse Flk-1 and Flt-1 labeling (Figure 2D). In mature fibers, at...
Cting samples from autistic young children, specifically for the postmortem tissues from autistic individuals; on
Cting samples from autistic young children, specifically for the postmortem tissues from autistic individuals;...
Days three days 1 and three days Parameters Protein synthesis Protein synthesis Protein
Days three days 1 and three days Parameters Protein synthesis Protein synthesis Protein synthesis...
Cultures.The Journal of Clinical InvestigationWe hypothesized that the elevated neuron death observed when microglia are
Cultures.The Journal of Clinical InvestigationWe hypothesized that the elevated neuron death observed when microglia...
Are studies that show the function of myokines in the general metabolism from the physique
Are studies that show the function of myokines in the general metabolism from the...
To detect viral responses the brightness is of significantly less concern compared to detecting T-cell
To detect viral responses the brightness is of significantly less concern compared to detecting...
Ing fibers exhibited diffuse Flk-1 and Flt-1 labeling (Figure 2D). In Integrin Associated Protein/CD47 Proteins
Ing fibers exhibited diffuse Flk-1 and Flt-1 labeling (Figure 2D). In Integrin Associated Protein/CD47...
Nfiltrating the damage internet site, resulting in a loss of axonal connections as well as
Nfiltrating the damage internet site, resulting in a loss of axonal connections as well...
Ese 3 PPARs contribute for the maintenance of mitochondria inside a tissue-specific manner. 7.3. Reduction
Ese 3 PPARs contribute for the maintenance of mitochondria inside a tissue-specific manner. 7.3....
An enrichment analysis performed SAE2 Proteins medchemexpress around the ACE PPI 3-kinase (PI3K) cascade, receptor
An enrichment analysis performed SAE2 Proteins medchemexpress around the ACE PPI 3-kinase (PI3K) cascade,...
Ft panel, decrease response in orange) which has a sustained response for that time time
Ft panel, decrease response in orange) which has a sustained response for that time...
D using the inner syringe and used for hTLC stimulation. PRP-BCT was made using the
D using the inner syringe and used for hTLC stimulation. PRP-BCT was made using...
Isruption from the PDL within the apical area (Figure 2B and 2C, Gremlin). Neutrophils were
Isruption from the PDL within the apical area (Figure 2B and 2C, Gremlin). Neutrophils...
Ion in certain regionstoo near the permanent tooth to come (Fig 1). Permanent tooth pericoronal
Ion in certain regionstoo near the permanent tooth to come (Fig 1). Permanent tooth...
Ding EGF-like ligand, NRG1, NRG2, NRG3, NRG4, and transforming development factor- gene expression. We detected
Ding EGF-like ligand, NRG1, NRG2, NRG3, NRG4, and transforming development factor- gene expression. We...
Ggest that each Angptl2 and Angptl3 ordinarily function in vivo to stimulate expansion of fetal
Ggest that each Angptl2 and Angptl3 ordinarily function in vivo to stimulate expansion of...
Ired insulin sensitivity [49]. We have found that inducing glucolipotoxicity employing PA and glucose in
Ired insulin sensitivity . We have found that inducing glucolipotoxicity employing PA and glucose...
As been reported that in a rabbit model of hindlimb ischemia, VEGF mRNA and protein
As been reported that in a rabbit model of hindlimb ischemia, VEGF mRNA and...
Ature and pre-warm Target Probe diluent to 40 within the incubator. 15.TGF-alpha Proteins custom
Ature and pre-warm Target Probe diluent to 40 within the incubator. 15.TGF-alpha Proteins custom...
Rns facilitate the formation of morphogen gradients which might be critical for selective cell recruitment
Rns facilitate the formation of morphogen gradients which might be critical for selective cell...
S the invasion assay. The data are presented as mean SD of three independent experiments.Orthotopic
S the invasion assay. The data are presented as mean SD of three independent...
AftAuthor ManuscriptAdv Healthc Mater. Writer manuscript; readily available in PMC 2020 March 16.Acri et al.Pagethat
AftAuthor ManuscriptAdv Healthc Mater. Writer manuscript; readily available in PMC 2020 March 16.Acri et...
T-derived EVs as enjoying a purpose during the inflammatory wound healing stage, but extra direct
T-derived EVs as enjoying a purpose during the inflammatory wound healing stage, but extra...
Nd Neurovascular Hyperlink, Department of Oncology, Katholieke Universiteit Leuven, 3000 Leuven, BelgiumEdited by Michel C.
Nd Neurovascular Hyperlink, Department of Oncology, Katholieke Universiteit Leuven, 3000 Leuven, BelgiumEdited by Michel...
Plication in flow cytometric evaluation of murine T cells. Such as, allelic variations of the
Plication in flow cytometric evaluation of murine T cells. Such as, allelic variations of...
In ECM composition is cancer. Changes in ECM composition can help create microenvironments conducive to
In ECM composition is cancer. Changes in ECM composition can help create microenvironments conducive...
Ical. Approaches: Right here we present a basic plasma EV enrichment protocol based on pluronic
Ical. Approaches: Right here we present a basic plasma EV enrichment protocol based on...
Ed applying Diff Quik (Dade AG, Dudingen, Switzerland). Cells on 5 random fields around the
Ed applying Diff Quik (Dade AG, Dudingen, Switzerland). Cells on 5 random fields around...
Ature and pre-warm Phosphatase Proteins manufacturer Target Probe diluent to 40 inside the incubator.
Ature and pre-warm Phosphatase Proteins manufacturer Target Probe diluent to 40 inside the incubator....
Serve as a delivery program that carries proteins, nucleic acids and lipids, that is essential
Serve as a delivery program that carries proteins, nucleic acids and lipids, that is...
Y IL-1 essential a disintegrin and metalloproteinase 17 (ADAM17)-dependent shedding on the ligand neuregulin-1 (NRG-1).
Y IL-1 essential a disintegrin and metalloproteinase 17 (ADAM17)-dependent shedding on the ligand neuregulin-1...
L enhancements may be extra to your protocol (see Area VII.14.5: step-by-step protocol). As an
L enhancements may be extra to your protocol (see Area VII.14.5: step-by-step protocol). As...
Nce intensities ('bright'), and (iii) exhibit small spectral overlap with other fluorochromes [282, 283]. The
Nce intensities (“bright”), and (iii) exhibit small spectral overlap with other fluorochromes ....
Rs are vital for standard alveolarization and angiogenesis.Children 2020, 7,8 of3.8. MicroRNAs MicroRNAs (miRs) are
Rs are vital for standard alveolarization and angiogenesis.Children 2020, 7,8 of3.8. MicroRNAs MicroRNAs (miRs)...
Muscle, and C2C12 myoblasts were cultured in GM. Flk-1 and Flt-1 transcripts had been readily
Muscle, and C2C12 myoblasts were cultured in GM. Flk-1 and Flt-1 transcripts had been...
Parallel to your outer edge resulting in a ring formation TNF Superfamily Proteins Gene ID
Parallel to your outer edge resulting in a ring formation TNF Superfamily Proteins Gene...
Rt for the respective minimum transmit delay [18],Appl. Sci. 2021, 11,6 ofn {1..NsnRt to the
Rt for the respective minimum transmit delay ,Appl. Sci. 2021, 11,6 ofn {1..NsnRt to...
F the questionnaire was an Attachment with 12 concerns which associated toF the questionnaire was
F the questionnaire was an Attachment with 12 concerns which associated toF the questionnaire...
Rought materials, all AM to ASTM surface condition with all the wroughtRought supplies, all AM
Rought materials, all AM to ASTM surface condition with all the wroughtRought supplies, all...
(p 0.05).Table 3. Benefits of many comparisons among scores for the investigated(p 0.05).Table three. Benefits
(p 0.05).Table 3. Benefits of many comparisons among scores for the investigated(p 0.05).Table three....
Of cement soil specimens. On the other hand, both the NaOf cement soil specimens. On
Of cement soil specimens. On the other hand, both the NaOf cement soil specimens....
Or the A382T mutation [290]. In the first case, zebrafish showedOr the A382T mutation [290].
Or the A382T mutation . In the first case, zebrafish showedOr the A382T mutation...
D 20 for 13 strains [41], which matches the glycerol yield that varies fromD 20
D 20 for 13 strains , which matches the glycerol yield that varies fromD...
Ive agents.4.two.1. Impact and Memory An instance that addresses the relationIve agents.4.two.1. Impact and Memory
Ive agents.4.two.1. Impact and Memory An instance that addresses the relationIve agents.4.two.1. Impact and...
Rator. (a) Lnorm error of all grids (b) Lnorm error ofRator. (a) Lnorm error of
Rator. (a) Lnorm error of all grids (b) Lnorm error ofRator. (a) Lnorm error...
E back is slightly arched, plus the tail head is elevated.E back is slightly arched,
E back is slightly arched, plus the tail head is elevated.E back is slightly...
The all round goal was to select essential parameters in great manufacturingThe Ethyl Vanillate Epigenetic
The all round goal was to select essential parameters in great manufacturingThe Ethyl Vanillate...
Assuming six MW/km2 ) and as much as 1 from the location in every singleAssuming
Assuming six MW/km2 ) and as much as 1 from the location in every...
To alleviate chilling tension and enhance shoot emergence, shoot growth andTo alleviate chilling stress and
To alleviate chilling tension and enhance shoot emergence, shoot growth andTo alleviate chilling stress...
Size of 10 pixels), couple attached to the specimen and identified toSize of ten pixels),
Size of 10 pixels), couple attached to the specimen and identified toSize of ten...
Resisted sprinting. Regarding kinematic analysis, the increased load brought on a disruptionResisted sprinting. Regarding kinematic
Resisted sprinting. Regarding kinematic analysis, the increased load brought on a disruptionResisted sprinting. Regarding...
F the companion BCI signal (for instance, P300, motor imagery, and so forth.F the companion
F the companion BCI signal (for instance, P300, motor imagery, and so forth.F the...
Increases as a consequence of a lower in the power harvested by personIncreases due to
Increases as a consequence of a lower in the power harvested by personIncreases due...
0005; (d) Spatiotemporal modify of carbon Benidipine Autophagy storage age in 2005010; (e) Spatiotemporal transform0005;
0005; (d) Spatiotemporal modify of carbon Benidipine Autophagy storage age in 2005010; (e) Spatiotemporal...
Le 3. Benefits of univariable ordinal regression analysis. 95 Confidence Interval Lower BoundLe 3. Final
Le 3. Benefits of univariable ordinal regression analysis. 95 Confidence Interval Lower BoundLe 3....
Tuberculosis (DR-TB) individuals globally [7,8] and specifically using the growing burden ofTuberculosis (DR-TB) patients globally
Tuberculosis (DR-TB) individuals globally and specifically using the growing burden ofTuberculosis (DR-TB) patients...
At Follow-Up in AT Group Adjust from Baseline to Follow-Up betweenAt Follow-Up in AT Group
At Follow-Up in AT Group Adjust from Baseline to Follow-Up betweenAt Follow-Up in AT...
Dge, there is certainly no study that could supply a connection betweenDge, there is no
Dge, there is certainly no study that could supply a connection betweenDge, there is...
Pectively. For that reason, from (3), we conclude that (1) normally holds and (2) holds
Pectively. For that reason, from (3), we conclude that (1) normally holds and (2)...
The initial step in the ICU monitoring pipeline incorporated a pre-processingThe first step in the
The initial step in the ICU monitoring pipeline incorporated a pre-processingThe first step in...
Population of n p particles, randomly dispersed within an initially boundedPopulation of n p particles,
Population of n p particles, randomly dispersed within an initially boundedPopulation of n p...
Ion has addressed such parts by way of a bigger contribution toward theIon has addressed
Ion has addressed such parts by way of a bigger contribution toward theIon has...
Amic resins secreted humic acids and tannin-derived supplies (n. two, three, four, acids areAmic resins
Amic resins secreted humic acids and tannin-derived supplies (n. two, three, four, acids areAmic...
To alleviate chilling anxiety and PX-478 Biological Activity improve shoot emergence, shoot growth andTo alleviate
To alleviate chilling anxiety and PX-478 Biological Activity improve shoot emergence, shoot growth andTo...
E. Figure 1a visualizes the total benign and malware HPC informationE. Figure 1a visualizes the
E. Figure 1a visualizes the total benign and malware HPC informationE. Figure 1a visualizes...
Formed consent. Active SARS-CoV-2 infection was diagnosed by means of detection of viralFormed consent. Active
Formed consent. Active SARS-CoV-2 infection was diagnosed by means of detection of viralFormed consent....
The (-)-Irofulven Biological Activity aqueous kind of the CO2 is instantaneously consumed in theThe aqueous
The (-)-Irofulven Biological Activity aqueous kind of the CO2 is instantaneously consumed in theThe...
Rmed in 367,703 UK Ziritaxestat supplier Biobank participants of European ancestries, andstatistical power erallyRmed in
Rmed in 367,703 UK Ziritaxestat supplier Biobank participants of European ancestries, andstatistical power erallyRmed...
The other hand, cover a far more asymmetrical asymmetrical variation on theThe other hand, cover
The other hand, cover a far more asymmetrical asymmetrical variation on theThe other hand,...
Stems.(a)(b) Figure five. Cooperative style for power allocation and subcarrierStems.(a)(b) Figure 5. Cooperative design for
Stems.(a)(b) Figure five. Cooperative style for power allocation and subcarrierStems.(a)(b) Figure 5. Cooperative design...
Lity Statement: Not applicable. Acknowledgments: S.S.'s perform is supportedLity Statement: Not applicable. Acknowledgments: S.S.'s operate
Lity Statement: Not applicable. Acknowledgments: S.S.’s perform is supportedLity Statement: Not applicable. Acknowledgments: S.S.’s...
Ated across the entire array of criteria C, referred to asAted across the entire array
Ated across the entire array of criteria C, referred to asAted across the entire...
He identical process as utilized for the radar subsystem. The MIHe identical procedure as applied
He identical process as utilized for the radar subsystem. The MIHe identical procedure as...
Hich, in our opinion, has an elevated capacity to bring innovationHich, in our opinion, has
Hich, in our opinion, has an elevated capacity to bring innovationHich, in our opinion,...
Ow shown in Figure three and neglects the inlet and Polmacoxib site outlet tubes.Ow shown
Ow shown in Figure three and neglects the inlet and Polmacoxib site outlet tubes.Ow...
Oo viscous. Hence, the rubber-powder content should not be as well high.Oo viscous. Thus, the
Oo viscous. Hence, the rubber-powder content should not be as well high.Oo viscous. Thus,...
Rum was a cyclic counting process of short-term load-time history, andRum was a cyclic counting
Rum was a cyclic counting process of short-term load-time history, andRum was a cyclic...
(p 0.05).Table three. Results of various comparisons amongst scores for the investigated(p 0.05).Table three. Results
(p 0.05).Table three. Results of various comparisons amongst scores for the investigated(p 0.05).Table three....
Gnancy patient group, levels of IL-2 and MCP-3 even temporarily enhancedGnancy patient group, levels of
Gnancy patient group, levels of IL-2 and MCP-3 even temporarily enhancedGnancy patient group, levels...
To alleviate chilling pressure and enhance shoot emergence, shoot development andTo alleviate chilling anxiety and
To alleviate chilling pressure and enhance shoot emergence, shoot development andTo alleviate chilling anxiety...
10] C2 Ceramide In stock inside the x-axis and Charybdotoxin Data Sheet y-axis directions to
10] C2 Ceramide In stock inside the x-axis and Charybdotoxin Data Sheet y-axis directions...
And from any device (in unique Apple iPad, Samsung SM-T515, andAnd from any device (in
And from any device (in unique Apple iPad, Samsung SM-T515, andAnd from any device...
Odriozola-Mart ez 1,10, 2Citation: Ram ez de la Streptonigrin supplier Piscina-Vi ez, X.; varez-HermsOdriozola-Mart ez
Odriozola-Mart ez 1,10, 2Citation: Ram ez de la Streptonigrin supplier Piscina-Vi ez, X.; varez-HermsOdriozola-Mart...
En the channel bottom as well as the horizontal plane; dimensionless shear; kinematicEn the channel
En the channel bottom as well as the horizontal plane; dimensionless shear; kinematicEn the...
Simplified connectivity, then we further give such isoparametric hypersurface a rigiditySimplified connectivity, then we further
Simplified connectivity, then we further give such isoparametric hypersurface a rigiditySimplified connectivity, then we...
E second chamber respectively [4]. Q1v , and Q2v would be theE second chamber respectively
E second chamber respectively . Q1v , and Q2v would be theE second chamber...
Hyp), variety I collagen gels (COL1), sort III collagen gels (COLHyp), type I collagen gels
Hyp), variety I collagen gels (COL1), sort III collagen gels (COLHyp), type I collagen...
KEO)-loaded nanoliposomes. The authors reported that incorporating chitosan coating containingKEO)-loaded nanoliposomes. The authors reported that
KEO)-loaded nanoliposomes. The authors reported that incorporating chitosan coating containingKEO)-loaded nanoliposomes. The authors reported...
EmentWater 2021, 13,7 of(36 and 47 /L, respectively) have been identified. The maximum rates have
EmentWater 2021, 13,7 of(36 and 47 /L, respectively) have been identified. The maximum rates...
The tube, additionally they Thromboxane B2 Epigenetic Reader Domain pointed out that the effects of
The tube, additionally they Thromboxane B2 Epigenetic Reader Domain pointed out that the effects...
Tion sorbents is presented in Figure three. spiked at 10 couple of compounds, suchTion sorbents
Tion sorbents is presented in Figure three. spiked at 10 couple of compounds, suchTion...
]. In theory, regional organizing led by specialist authorities within the field]. In theory, regional
]. In theory, regional organizing led by specialist authorities within the field]. In theory,...
To alleviate chilling stress and boost shoot emergence, shoot growth andTo alleviate chilling strain and
To alleviate chilling stress and boost shoot emergence, shoot growth andTo alleviate chilling strain...
Entive water- widel tested and typically utilised on archaeological practice [80]. [7], withEntive water- widel
Entive water- widel tested and typically utilised on archaeological practice . , withEntive water-...
Ed in DMEM supplemented with 10 FBS, 1x Antibiotic-Antimycotic. All cell linesEd in DMEM supplemented
Ed in DMEM supplemented with 10 FBS, 1x Antibiotic-Antimycotic. All cell linesEd in DMEM...
Remote Sens. 2021, 13,15 of(a)(b) Figure 7. Cooperative design ( = 0.9) with chunk subcarrierRemote
Remote Sens. 2021, 13,15 of(a)(b) Figure 7. Cooperative design ( = 0.9) with chunk...
Of be on account of the manipulation on the object, a hypothesisOf be resulting from
Of be on account of the manipulation on the object, a hypothesisOf be resulting...
Ely. To validate the reliability in the reported algorithms, just about every optimizerEly. To validate
Ely. To validate the reliability in the reported algorithms, just about every optimizerEly. To...
Y Lab of Poyang Lake Wetland and Watershed Investigation of MinistryY Lab of Poyang Lake
Y Lab of Poyang Lake Wetland and Watershed Investigation of MinistryY Lab of Poyang...
Ted much more on-task thoughts and significantly less MW than younger adults, whichTed extra on-task
Ted much more on-task thoughts and significantly less MW than younger adults, whichTed extra...
Bioclimatic zones along a sharp altitudinal cline in a Mediterranean contextBioclimatic zones along a sharp
Bioclimatic zones along a sharp altitudinal cline in a Mediterranean contextBioclimatic zones along a...
Nificant PF-06873600 Formula therapy by GA interactions in any white or grey matterNificant therapy by
Nificant PF-06873600 Formula therapy by GA interactions in any white or grey matterNificant therapy...
Possess the property (13) of becoming straightforward. For example, by picking out asPossess the
Possess the property (13) of becoming straightforward. For example, by picking out asPossess the...
Salt fibers. Fiber Length 45 mm Diameter 0.7 mm Density 2150 kg/m3 YoungSalt fibers. Fiber
Salt fibers. Fiber Length 45 mm Diameter 0.7 mm Density 2150 kg/m3 YoungSalt fibers....
Duce 40 of its power from renewable sources [13]. Due to the availabilityDuce 40
Duce 40 of its power from renewable sources . Due to the availabilityDuce 40...
Ids Interact with the Human Bile Acid Transporter NTCPMelissa J. RuggieroIds Interact with all the
Ids Interact with the Human Bile Acid Transporter NTCPMelissa J. RuggieroIds Interact with all...
Eat flux transmitted by them. Based on the numerical model andConsume flux transmitted by them.
Eat flux transmitted by them. Based on the numerical model andConsume flux transmitted by...
G, 2003 [14] van Meerbeeck, 2005 [15] Zalcman, 2016 [16] III III 1st 1st 68.three
G, 2003 van Meerbeeck, 2005 Zalcman, 2016 III III 1st 1st...
M the ground. These procedures may be divided into the followingM the ground. These procedures
M the ground. These procedures may be divided into the followingM the ground. These...
Ibuted to newly formed carbonates (Figure 3c,d) [38,45,46]. In agreement withIbuted to newly formed carbonates
Ibuted to newly formed carbonates (Figure 3c,d) . In agreement withIbuted to newly formed...
Pecific humidity from the GPS antenna level to the leading levelPecific humidity in the GPS
Pecific humidity from the GPS antenna level to the leading levelPecific humidity in the...
Sity distributions, seemed to depend on the local location. We attributedSity distributions, seemed to depend
Sity distributions, seemed to depend on the local location. We attributedSity distributions, seemed to...
N be defined as follows: 1 max = arccos three (34)The resulting indicator canN
N be defined as follows: 1 max = arccos three (34)The resulting indicator canN...
Ures. Source: personal Figure 7. Structural kinds of of farmland covered pro-environmentalUres. Source: own Figure
Ures. Source: personal Figure 7. Structural kinds of of farmland covered pro-environmentalUres. Source: own...
On to prevent the engine from ineffi5. Comparison with Commercially submodeOn to stop the engine
On to prevent the engine from ineffi5. Comparison with Commercially submodeOn to stop the...
Ticle is an open access short article distributed under the terms andTicle is an open
Ticle is an open access short article distributed under the terms andTicle is an...
Proved as IQP-0528 In Vivo described in [162].Metals 2021, 11,24 ofFigure 20. IMC layer formation
Proved as IQP-0528 In Vivo described in .Metals 2021, 11,24 ofFigure 20. IMC layer...
Damping ratios=0.=0.K , (t) 50 -1 -J. Mar. Sci. Eng. 2021, 9, x FORDamping ratios=0.=0.K
Damping ratios=0.=0.K , (t) 50 -1 -J. Mar. Sci. Eng. 2021, 9, x FORDamping...
Lgorithms) will probably be important when the sample size increases.Author ContributionsLgorithms) are going to be
Lgorithms) will probably be important when the sample size increases.Author ContributionsLgorithms) are going to...
Ing aging remedy is believed to become a result of soluteIng aging remedy is believed
Ing aging remedy is believed to become a result of soluteIng aging remedy is...
Ale (in-oral exposure time), the worth in the dominance price wasAle (in-oral exposure time), the
Ale (in-oral exposure time), the worth in the dominance price wasAle (in-oral exposure time),...
F BGCs 1.20 or 1.31 correlates with griseusinproduction, samples in the 10 h timeF BGCs
F BGCs 1.20 or 1.31 correlates with griseusinproduction, samples in the 10 h timeF...
five in [14]). The parameters are significantly less than the equations. This can be a5
five in ). The parameters are significantly less than the equations. This can be...
.org/licenses/by/ 4.0/).Energies 2021, 14, 7149. https://doi.org/10.3390/enhttps://www.mdpi.com.org/licenses/by/ four.0/).Energies 2021, 14, 7149. https://doi.org/10.3390/enhttps://www.mdpi.com/journal/energiesEnergies 2021, 14,two ofstubborn/newly emerged
.org/licenses/by/ 4.0/).Energies 2021, 14, 7149. https://doi.org/10.3390/enhttps://www.mdpi.com.org/licenses/by/ four.0/).Energies 2021, 14, 7149. https://doi.org/10.3390/enhttps://www.mdpi.com/journal/energiesEnergies 2021, 14,two ofstubborn/newly...
R+3 was made use of to acquire data on the mechanical stresses inR+3 was utilised
R+3 was made use of to acquire data on the mechanical stresses inR+3 was...
Malvern, England) and zeta possible measurement utilizing (Horiba SZ100 nanoparticle analyzerMalvern, England) and zeta potential
Malvern, England) and zeta possible measurement utilizing (Horiba SZ100 nanoparticle analyzerMalvern, England) and zeta...
The nature in the substituents on ring A. Moveltipril web compound three (EC50 = 40
The nature in the substituents on ring A. Moveltipril web compound three (EC50 =...
V.three.5 together with the support of SimaPro LCA software 9.0. Considering that basalt fiberV.three.5 together
V.three.5 together with the support of SimaPro LCA software 9.0. Considering that basalt fiberV.three.5...
Zigbee, and so forth. Even so, 2G/3G wireless networks are costly and consumeZigbee, and so
Zigbee, and so forth. Even so, 2G/3G wireless networks are costly and consumeZigbee, and...
Performed by technical support of OK C6 Ceramide custom synthesis Servis )BioPro, Ltd. Corporation. ThePerformed
Performed by technical support of OK C6 Ceramide custom synthesis Servis )BioPro, Ltd. Corporation....
Nitude, Cu and Sn by two orders of magnitude, and BiNitude, Cu and Sn by
Nitude, Cu and Sn by two orders of magnitude, and BiNitude, Cu and Sn...
Mass and energy balances. Savings in CO2 emissions with either ofMass and power balances. Savings
Mass and energy balances. Savings in CO2 emissions with either ofMass and power balances....
H -Si3 N4 : five of them are Ag , two are EH -Si3 N4
H -Si3 N4 : five of them are Ag , two are EH -Si3...
Generated by simulation from bearing dynamic models. Hu et al. [135] thought ofGenerated by simulation
Generated by simulation from bearing dynamic models. Hu et al. thought ofGenerated by...
His study utilizes astudy utilizes a U-Net model, which was previouslyHis study utilizes astudy makes
His study utilizes astudy utilizes a U-Net model, which was previouslyHis study utilizes astudy...
F the peptide array signals appears as peaks with corresponding regionsF the peptide array signals
F the peptide array signals appears as peaks with corresponding regionsF the peptide array...
Re to TM is building a barrier to helpful integration. TheyRe to TM is producing
Re to TM is building a barrier to helpful integration. TheyRe to TM is...
The passage of at the least Decanoyl-L-carnitine custom synthesis various ions through the same location.The
The passage of at the least Decanoyl-L-carnitine custom synthesis various ions through the same...
Oils for instance monoterpenes, have also been tested and employed asOils such as monoterpenes, have
Oils for instance monoterpenes, have also been tested and employed asOils such as monoterpenes,...
'pw-ss e'ppH'1-pw-ac 12.96 (Z)-Semaxanib site e'pw-ac 0.As illustrated in Table 3, the'pw-ss e'ppH'1-pw-ac 12.96 e'pw-ac
‘pw-ss e’ppH’1-pw-ac 12.96 (Z)-Semaxanib site e’pw-ac 0.As illustrated in Table 3, the‘pw-ss e’ppH’1-pw-ac 12.96...
A Wick-type stochastic space and with GDCOs may be given asA Wick-type stochastic space and
A Wick-type stochastic space and with GDCOs may be given asA Wick-type stochastic space...
PH 8.0 (ten mM Tris-HCl, 5 mM EDTA, one hundred mM NaCl), (2) 100
PH 8.0 (ten mM Tris-HCl, 5 mM EDTA, one hundred mM NaCl), (2) 100...
Ms and Bone Marrow Transplantation, University Hospital in Wroclaw (Lab2); DepartmentMs and Bone Marrow Transplantation,
Ms and Bone Marrow Transplantation, University Hospital in Wroclaw (Lab2); DepartmentMs and Bone Marrow...
D 0.768 -1 m-1 at photon energy 1.49 and four.40 eV, = = respectively.
D 0.768 -1 m-1 at photon energy 1.49 and four.40 eV, = = respectively....
three.294 kcal/mol), followed by 4-phenoxyphenol (-22.191 kcal/mol) and 9H-Molecules 2021, 26,eight ofxanthene-3.294 kcal/mol), followed by
three.294 kcal/mol), followed by 4-phenoxyphenol (-22.191 kcal/mol) and 9H-Molecules 2021, 26,eight ofxanthene-3.294 kcal/mol), followed...
2C). were nificantly elevated at 50 and 100 TNF-, MCP-1, VEGF-AA, SBP-3264 web PDGF-BB and2C).
2C). were nificantly elevated at 50 and 100 TNF-, MCP-1, VEGF-AA, SBP-3264 web PDGF-BB...
Ibuted to newly formed carbonates (Figure 3c,d) [38,45,46]. In agreement withIbuted to newly formed carbonates
Ibuted to newly formed carbonates (Figure 3c,d) . In agreement withIbuted to newly formed...
Erivative of F ( x ) at x0 is defined as FgH ( xErivative of
Erivative of F ( x ) at x0 is defined as FgH ( xErivative...
And agreed to the published version of the manuscript. Funding: ThisAnd agreed towards the published
And agreed to the published version of the manuscript. Funding: ThisAnd agreed towards the...
T resistant to the supplementation of wheat, exhibiting the smallest improveT resistant to the supplementation
T resistant to the supplementation of wheat, exhibiting the smallest improveT resistant to the...
Rm, similar to a unique downsampling process, we predicted that theRm, similar to a specific
Rm, similar to a unique downsampling process, we predicted that theRm, similar to a...
F epitopes for the human Nimbolide custom synthesis immune system to recognize in comparisonF epitopes
F epitopes for the human Nimbolide custom synthesis immune system to recognize in comparisonF...
Statistical solutions. Because of this, new research should be directed toStatistical approaches. Because of this,
Statistical solutions. Because of this, new research should be directed toStatistical approaches. Because of...
Vely higher value of ultimate tensile strength, which was above 200 MPa.Vely greater value of
Vely higher value of ultimate tensile strength, which was above 200 MPa.Vely greater value...
= L +Mk (S PGOi ). The farthest proper point of the intervalfStype-= L +Mk
= L +Mk (S PGOi ). The farthest proper point of the intervalfStype-= L...
1719 cm-1 is related stretch due to the aromatic aromatic ring (aromatic1719 cm-1 is associated
1719 cm-1 is related stretch due to the aromatic aromatic ring (aromatic1719 cm-1 is...
Ial Crush Impactor/mmDisplacement at SCOccurrence ThreePoint Bending/mmShort Circuit CriterionBatteriesIal Crush Impactor/mmDisplacement at SCOccurrence
Ial Crush Impactor/mmDisplacement at SCOccurrence ThreePoint Bending/mmShort Circuit CriterionBatteriesIal Crush Impactor/mmDisplacement at SCOccurrence ThreePoint...
Rains are produced of tiny internal combustion (IC) engines and bigRains are produced of smaller
Rains are produced of tiny internal combustion (IC) engines and bigRains are produced of...
Etabular alumina/zirconium ceapplied for the deposition ofof bioactive glass coatingsEtabular alumina/zirconium ceapplied for the deposition
Etabular alumina/zirconium ceapplied for the deposition ofof bioactive glass coatingsEtabular alumina/zirconium ceapplied for the...
Generated by 500 iterations. The integrated AUC for all time points wasGenerated by 500 iterations.
Generated by 500 iterations. The integrated AUC for all time points wasGenerated by 500...
Tions, retirement windows, and withdrawal prices employing Ibbotson's Stocks, BondsTions, retirement windows, and withdrawal prices
Tions, retirement windows, and withdrawal prices employing Ibbotson’s Stocks, BondsTions, retirement windows, and withdrawal...
Ter than that in Figure 4. Table two. As shown in Table 3, theTer than
Ter than that in Figure 4. Table two. As shown in Table 3, theTer...
Y squeezing the muscles surrounding the anal canal. This maneuver wasY squeezing the muscles surrounding
Y squeezing the muscles surrounding the anal canal. This maneuver wasY squeezing the muscles...
Tional cars with diverse IC engine energy ratings and distinctive automobileTional automobiles with unique IC
Tional cars with diverse IC engine energy ratings and distinctive automobileTional automobiles with unique...
That must be viewed as in tuning the fantastic mechanical properties. ForThat needs to be
That must be viewed as in tuning the fantastic mechanical properties. ForThat needs to...
L them is an example of how Seleucid rule dealt withL them is an instance
L them is an example of how Seleucid rule dealt withL them is an...
Frequently tested interferant. Testing the adsorptionof similar chemcal structures is extremelyUsually tested interferant. Testing the
Frequently tested interferant. Testing the adsorptionof similar chemcal structures is extremelyUsually tested interferant. Testing...
Ure (n = 14) a. 0.9 mm3 23 sixteen (eleven.8) 5 (18.5) 9 (13.2) 3
Ure (n = 14) a. 0.9 mm3 23 sixteen (eleven.8) 5 (18.5) 9 (13.2)...
Ia. Minerals 2021, 11, 1175. https://doi.org/10.3390/ min11111175 Academic Editor: Sytle M. Antao Received: 2 September
Ia. Minerals 2021, 11, 1175. https://doi.org/10.3390/ min11111175 Academic Editor: Sytle M. Antao Received: 2...
Id (0.064 , w/v), MCC950 MedChemExpress oxalate (0.052 , min and EDTA acid answer composed
Id (0.064 , w/v), MCC950 MedChemExpress oxalate (0.052 , min and EDTA acid answer...
UtaMAX have been infected at a confluency of 800 and an MOI of 0.five
UtaMAX have been infected at a confluency of 800 and an MOI of 0.five...
Fect and evolution in t. The evolution is p acting upon O, the evolution suffers
Fect and evolution in t. The evolution is p acting upon O, the evolution...
Causedthe get in touch with with the unit cells within the inside the vertical direction
Causedthe get in touch with with the unit cells within the inside the vertical...
Plus the happen to be performed. Table 1 lists preceding research making use of IAA
Plus the happen to be performed. Table 1 lists preceding research making use of...
Id (0.064 , w/v), oxalate (0.052 , min and EDTA acid resolution composed 40 min.
Id (0.064 , w/v), oxalate (0.052 , min and EDTA acid resolution composed 40...
Environments [79]. When the 560 nm illuminating light is irradiated around the fully immersed microlens,
Environments . When the 560 nm illuminating light is irradiated around the fully immersed...
Ht of 0.0827 C/year inside the years from 2000 to 2019, though the vegetation
Ht of 0.0827 C/year inside the years from 2000 to 2019, though the vegetation...
Or PWH who are suspected of obtaining reactivation illness and that are Betamethasone disodium MedChemExpress
Or PWH who are suspected of obtaining reactivation illness and that are Betamethasone disodium...
Al and metropolitan level more than time periods. Any discrepancy among GYKI 52466 Autophagy actual
Al and metropolitan level more than time periods. Any discrepancy among GYKI 52466 Autophagy...
Tion depth was also dependent on the variety of MNs inside the array or, far
Tion depth was also dependent on the variety of MNs inside the array or,...
As '' inside the JPH203 Purity & Documentation figure above. Mainly because of their comparatively
As “” inside the JPH203 Purity & Documentation figure above. Mainly because of their...
E exactly the same size, but are placed at unique shooting In Figure 5a, objects
E exactly the same size, but are placed at unique shooting In Figure 5a,...
In Figure 5b, the adsorption isotherm and and pore size distribution analyzed by using the
In Figure 5b, the adsorption isotherm and and pore size distribution analyzed by using...
Crack width = 0.1 mm, crack depth = five mm; (f) crack width = 0.1
Crack width = 0.1 mm, crack depth = five mm; (f) crack width =...
Nt fermentation problems, strain form and substrate utilised, hence offering additional rhamnolipid production and yield.Dissolve
Nt fermentation problems, strain form and substrate utilised, hence offering additional rhamnolipid production and...
Ies demonstrated the highest development rate inhibition just after exposure to the KomPC sample. The
Ies demonstrated the highest development rate inhibition just after exposure to the KomPC sample....
Manage remedies. It was previously reported that the concentrations of extract utilized in current experiment
Manage remedies. It was previously reported that the concentrations of extract utilized in current...
Ficult to dissolve following hot water extraction despite the softening of algae. In the course
Ficult to dissolve following hot water extraction despite the softening of algae. In the...
E entire bridge.Author Contributions: Conceptualization, W.W.; investigation, W.W.; validation, M.S., W.W.; writing--original draft preparation, W.W.;
E entire bridge.Author Contributions: Conceptualization, W.W.; investigation, W.W.; validation, M.S., W.W.; writing–original draft preparation,...
Is is also inside the anticipated error of hypsometer-based height measurements someter-based height measurements [66].[66].Figure
Is is also inside the anticipated error of hypsometer-based height measurements someter-based height measurements...
Lative gene expression for isolates on the identical species. It was shown that the gene
Lative gene expression for isolates on the identical species. It was shown that the...
Addition, a 2-dehydro derivative was isolated from a mutant of Allium ampeloprasum, reported as yayoisaponin
Addition, a 2-dehydro derivative was isolated from a mutant of Allium ampeloprasum, reported as...
F the electrolyte along with the resistance at the interface amongst the electrode along with
F the electrolyte along with the resistance at the interface amongst the electrode along...
Nd shipping contribute largely to the accumulation of toxic chemical substances in marine ecosystems such
Nd shipping contribute largely to the accumulation of toxic chemical substances in marine ecosystems...
Evice. Self-reported dietary and Goralatide manufacturer Physical activity patterns had been recorded primarily based on
Evice. Self-reported dietary and Goralatide manufacturer Physical activity patterns had been recorded primarily based...
Mparison. In an effort to examine the Pt(IV) reduction behavior of active cells with or
Mparison. In an effort to examine the Pt(IV) reduction behavior of active cells with...
Ose, 0.25 glucose, and 0.3 to 16 xylose and mannose. As a
Ose, 0.25 glucose, and 0.3 to 16 xylose and mannose. As a heterogeneous polymer,...
Or CH-HDTMA, respectively. For both SMZs, the N:C ratio was 0.03, which corresponds towards the
Or CH-HDTMA, respectively. For both SMZs, the N:C ratio was 0.03, which corresponds towards...
Side of bends or other certain lateral position. However, it ought to be noted that
Side of bends or other certain lateral position. However, it ought to be noted...
The white tone, which PC1 0.143 0.552 0.627 0.532 96.540 for probably the most component,
The white tone, which PC1 0.143 0.552 0.627 0.532 96.540 for probably the most...
Sitization by facilitating drug interactions with their JNJ-42253432 custom synthesis cytoplasmic targets. The left panel
Sitization by facilitating drug interactions with their JNJ-42253432 custom synthesis cytoplasmic targets. The left...
Nd the height model of residual supplies in nano ZrO2 ultra-precision grinding was established. The
Nd the height model of residual supplies in nano ZrO2 ultra-precision grinding was established....
Ength of tubes dropped to 58.1, 36.three, and 4.9 when treated with 2.5-10
Ength of tubes dropped to 58.1, 36.three, and 4.9 when treated with 2.5-10 BTDE....
S(7t) cos(9t) , 8 eight 8 524288r 131072r 1048576rwith: = r --531z6 225z6
S(7t) cos(9t) , 8 eight 8 524288r 131072r 1048576rwith: = r –531z6 225z6 21z4...
E have also informally tested FSCT on ALS point GS-626510 Epigenetics clouds with reduce height
E have also informally tested FSCT on ALS point GS-626510 Epigenetics clouds with reduce...
The technique performance. eight. RAN Decomposition Scheme As stated earlier in Section 2.two, the ever-increasing
The technique performance. eight. RAN Decomposition Scheme As stated earlier in Section 2.two, the...
W the whole history on the material to predict its behavior following the thermomechanical therapy.
W the whole history on the material to predict its behavior following the thermomechanical...
Hot water extraction, a sizable quantity of fibers were dispersed within the agar answer and
Hot water extraction, a sizable quantity of fibers were dispersed within the agar answer...
Performed a series of experiments presented at length in [4], exactly where we tackled the
Performed a series of experiments presented at length in , exactly where we tackled...
Was covered by the project sponsored by Division of Science and Technologies, Govt. of India.
Was covered by the project sponsored by Division of Science and Technologies, Govt. of...
Nalyzing the impact in the major handle signal u around the circuit. Instead, the leakage
Nalyzing the impact in the major handle signal u around the circuit. Instead, the...
Plus the have already been performed. Table 1 lists previous studies using IAA and also
Plus the have already been performed. Table 1 lists previous studies using IAA and...
Surface also indicates the presence of Cu and Zr. In addition, an increase in C
Surface also indicates the presence of Cu and Zr. In addition, an increase in...
E expression or upregulation of cytokines (TNF-, IL-6 and IL1), chemokines (CCL2, CCL20, and CXCL10),
E expression or upregulation of cytokines (TNF-, IL-6 and IL1), chemokines (CCL2, CCL20, and...
Ver 1500 m 2 and 66 churches with an Matthew, Isaac, and Cristine--the Initial Martyrs
Ver 1500 m 2 and 66 churches with an Matthew, Isaac, and Cristine–the Initial...
Le hosts, and young and adult hosts. These analyses have been carried out using Past
Le hosts, and young and adult hosts. These analyses have been carried out using...
O been reported that high-pressure application and room-temperature 2-Bromo-6-nitrophenol manufacturer deformation stabilizes the omega phase
O been reported that high-pressure application and room-temperature 2-Bromo-6-nitrophenol manufacturer deformation stabilizes the omega...
E variations physicochemical PP: Nature: GA: without the need of house;Nature: Note: colour;
E variations physicochemical PP: Nature: GA: without the need of house;Nature: Note: colour; transparency;...
Input and output or only inputs, interaction with all the atmosphere; the representation in the
Input and output or only inputs, interaction with all the atmosphere; the representation in...
Um starch [16]. By way of example, larger starch contents are important for grains employed
Um starch . By way of example, larger starch contents are important for grains...
And the happen to be carried out. Table 1 lists prior research making use of
And the happen to be carried out. Table 1 lists prior research making use...
Tivity with the pairs of compounds (Table 1) colochiroside B2 (38) (Figure 7) and magnumoside
Tivity with the pairs of compounds (Table 1) colochiroside B2 (38) (Figure 7) and...
Nd M.A.M.-P.; data curation, O.L.-G. and G.I.P.-L.; writing-- original draft Goralatide Description preparation, G.I.P.-L.; writing--review
Nd M.A.M.-P.; data curation, O.L.-G. and G.I.P.-L.; writing– original draft Goralatide Description preparation, G.I.P.-L.;...
City youth-oriented policies [513].Figure three. Dynamics of altering share of young adults in the 169-year-old
City youth-oriented policies .Figure three. Dynamics of altering share of young adults in the...
Ich was exposed to PTZ (0.six g/mL) for 24 h. The PTZ treatedtoxic have been
Ich was exposed to PTZ (0.six g/mL) for 24 h. The PTZ treatedtoxic have...
Calibacterium and Roseburia (Supplementary Table S1). No differences had been observed in neighborhood richness or
Calibacterium and Roseburia (Supplementary Table S1). No differences had been observed in neighborhood richness...
E have been collected after sequen4 of 19 tially remedy with alkali, acid, and bleaching
E have been collected after sequen4 of 19 tially remedy with alkali, acid, and...
Al limit within the Kerr spacetime except the event horizon.Universe 2021, 7,12 ofIn the study
Al limit within the Kerr spacetime except the event horizon.Universe 2021, 7,12 ofIn the...
Ultivation [16]. Similarly, shading increased the vegetative growth but repressed the production of lemon trees
Ultivation . Similarly, shading increased the vegetative growth but repressed the production of lemon...
And also the have already been carried out. Table 1 lists prior research working with
And also the have already been carried out. Table 1 lists prior research working...
B84.584.five b 84.584.5 0.two 85.50.0 85.5 85.9 0.1 85.9 eight 0.0 0.six the71.9
B84.584.five b 84.584.5 0.two 85.50.0 85.5 85.9 0.1 85.9 eight 0.0 0.six the71.9 a...
Was exposed to unclean water. This causes the 20(S)-Hydroxycholesterol Epigenetic Reader Domain pollution of superficial
Was exposed to unclean water. This causes the 20(S)-Hydroxycholesterol Epigenetic Reader Domain pollution of...
On the teachers. Figure six. Traits of your teachers.three.two.3. Data Evaluation This investigation followed Creswell's
On the teachers. Figure six. Traits of your teachers.three.two.3. Data Evaluation This investigation followed...
JNJ-42253432 Formula nanoparticles may be significantly enhan ticles, enhancing the sensing capacity in the nanoparticles.
JNJ-42253432 Formula nanoparticles may be significantly enhan ticles, enhancing the sensing capacity in the...
E presence involvement of two different hydrogenase enzymes is predicted fromproduction, exactly where Pt(IV) [25].
E presence involvement of two different hydrogenase enzymes is predicted fromproduction, exactly where Pt(IV)...
Ose, 0.25 glucose, and 0.three to 16 xylose and mannose. As a
Ose, 0.25 glucose, and 0.three to 16 xylose and mannose. As a heterogeneous polymer,...
Sing the current prediction model, and after that their d -axes elements are obtained via
Sing the current prediction model, and after that their d -axes elements are obtained...
S as (GP) appears as a chitectural In this [38,39]. Generative Programming Programming a trusted
S as (GP) appears as a chitectural In this . Generative Programming Programming a...
Synthesizers synthesizers [12024]. within the field of mechanically linked artificial photosynthetic models, one particular sophisticated
Synthesizers synthesizers . within the field of mechanically linked artificial photosynthetic models, one particular...
Lthough the type of XRD gear is less crucial, micro-focused XRD gear using a 2D-detector
Lthough the type of XRD gear is less crucial, micro-focused XRD gear using a...
The planned synthetic tactic was straightforward (Scheme two). The isocopalic hydroxyaldehyde (9) obtained by a
The planned synthetic tactic was straightforward (Scheme two). The isocopalic hydroxyaldehyde (9) obtained by...
Bioactive compound recovery in the cornelian cherry extracts had been obtained at 60 (v/v).
Bioactive compound recovery in the cornelian cherry extracts had been obtained at 60 (v/v)....
Gorithm, the authors determined the limits of shots (series of consecutive photos representing a continuous
Gorithm, the authors determined the limits of shots (series of consecutive photos representing a...
Enna proteins' was one of the most enriched KEGG pathway, followed by `Phenylpropanoid biosynthesis', `Glycine,
Enna proteins’ was one of the most enriched KEGG pathway, followed by `Phenylpropanoid biosynthesis’,...
By the Major Science and Technology Programs and Unique Topics of Fujian Province: 2020NZ012013; the
By the Major Science and Technology Programs and Unique Topics of Fujian Province: 2020NZ012013;...
The initial Pt(0) crystal nuclei (1st slow reaction). After Pt(0) nuclei are decreased by H2
The initial Pt(0) crystal nuclei (1st slow reaction). After Pt(0) nuclei are decreased by...
Igating the water use qualities of diverse epiphyte groups remains scarce and difficult. Together with
Igating the water use qualities of diverse epiphyte groups remains scarce and difficult. Together...
On the OWTs and the subsequent modelling of chl-a might be seen in Figure 11,
On the OWTs and the subsequent modelling of chl-a might be seen in Figure...
Idence of time to the three event times by the Aalen ohansen estimator adjusted for
Idence of time to the three event times by the Aalen ohansen estimator adjusted...
Ction Agency (EPA) developed a GHG emissions system, beneath the Clean Air Act [18], that
Ction Agency (EPA) developed a GHG emissions system, beneath the Clean Air Act ,...
And sulfate Fucose 30.9 Xylose 0.7 Glucose two.two Uronic acid 23.four
And sulfate Fucose 30.9 Xylose 0.7 Glucose two.two Uronic acid 23.four Molecular Weight Mw...
E case in other huge cities and medium towns on the country, is by use
E case in other huge cities and medium towns on the country, is by...
M (refconst, `type', power); 10: S_Usr1=Scalepsk(qam)mod(x, K); Step 2: Execute transmission with STBCs 11: X=
M (refconst, `type’, power); 10: S_Usr1=Scalepsk(qam)mod(x, K); Step 2: Execute transmission with STBCs 11:...
Up to 14.34 and 11.86 in aromatic YTX-465 Stearoyl-CoA Desaturase (SCD) fractions of
Up to 14.34 and 11.86 in aromatic YTX-465 Stearoyl-CoA Desaturase (SCD) fractions of shale...
Ca and 52.0 mg for a. cryptum (no matter the addition of Cu2 ). For
Ca and 52.0 mg for a. cryptum (no matter the addition of Cu2 )....
Discovered in Ascophyllum, Fucus and Undaria [7]. Laminarin can be a -glucan, mostly composed of
Discovered in Ascophyllum, Fucus and Undaria . Laminarin can be a -glucan, mostly composed...
Al solutions. Stock solutions of 0.2M MgCl2 , 0.2M BaCl2 , and 0.two Cs2 CO3
Al solutions. Stock solutions of 0.2M MgCl2 , 0.2M BaCl2 , and 0.two Cs2...
The planned synthetic tactic was straightforward (Scheme two). The isocopalic hydroxyaldehyde (9) obtained by a
The planned synthetic tactic was straightforward (Scheme two). The isocopalic hydroxyaldehyde (9) obtained by...
Dwide, 1090 Vienna, Austria; [email protected] (M.H.); [email protected] (I.S.); [email protected] (P.B.); [email protected] (M.M.); [email protected] (C.S.); [email protected]
Dwide, 1090 Vienna, Austria; [email protected] (M.H.); [email protected] (I.S.); [email protected] (P.B.); [email protected] (M.M.); [email protected] (C.S.);...
Idly increasing countries [2]. Additionally, the deterioration of transportation infraGYKI 52466 iGluR structure has accelerated
Idly increasing countries . Additionally, the deterioration of transportation infraGYKI 52466 iGluR structure has...
Nics. In some circumstances, such therapy is inappropriate. (h, c) are continual units for physical
Nics. In some circumstances, such therapy is inappropriate. (h, c) are continual units for...
For resolutions lower than 0.five cm-1 , the absorbance bands of water may well develop
For resolutions lower than 0.five cm-1 , the absorbance bands of water may well...
By the Key Science and Technologies Bomedemstat MedChemExpress Programs and Specific Topics of Fujian Province:
By the Key Science and Technologies Bomedemstat MedChemExpress Programs and Specific Topics of Fujian...
Ning track very carefully, as a result requiring a large work and not suited for
Ning track very carefully, as a result requiring a large work and not suited...
Ex specimen such as environmental or biological samples [7,8]. Sound phase extraction (SPE) is often
Ex specimen such as environmental or biological samples . Sound phase extraction (SPE) is...
Ofessional excavations [14] in along with a hacked Kinect successfully utilized by Arc-Team sensors [12].
Ofessional excavations in along with a hacked Kinect successfully utilized by Arc-Team sensors...
Moves to much more sophisticated instruments, for instance hybrid models, as shown and discussed in
Moves to much more sophisticated instruments, for instance hybrid models, as shown and discussed...
S. Figure six. S-N curves of CG, SMGTed, and A-SMGTed Zr-4 samples.For the stress-controlled Elsulfavirine
S. Figure six. S-N curves of CG, SMGTed, and A-SMGTed Zr-4 samples.For the stress-controlled...
And ER strain in JI017-treated ovarian cancer cells. Recent reports have revealed that prolonged cellular
And ER strain in JI017-treated ovarian cancer cells. Recent reports have revealed that prolonged...
E typical calculation formula is shown as Formula (8). 1 n x = xi (8)
E typical calculation formula is shown as Formula (8). 1 n x = xi...
Carried out throughout the COVID19 pandemic; therefore, there measurements have been taken weekly in numerous
Carried out throughout the COVID19 pandemic; therefore, there measurements have been taken weekly in...
T k two be an integer. Then there exists a good helpful computable continual c
T k two be an integer. Then there exists a good helpful computable continual...
Sequential two-step by reported in vivo antioxidant activity of your EtOAc (BDE). in mice [10].
Sequential two-step by reported in vivo antioxidant activity of your EtOAc (BDE). in mice...
Tarted recruitmentIFN Sort IIIFN Variety III Basic IFN program: Target plasmacytoid dendritic cellsNo trials identifieddaxdilimab
Tarted recruitmentIFN Sort IIIFN Variety III Basic IFN program: Target plasmacytoid dendritic cellsNo trials...
F 30 mg/kg manage for 10, 30 in 90 90 days of shown in Figure
F 30 mg/kg manage for 10, 30 in 90 90 days of shown in...
Principles are as follows: firstly, the gas fluid flows out in the gas-liquid separator, then
Principles are as follows: firstly, the gas fluid flows out in the gas-liquid separator,...
Sel, Switzerland. This article is an open access write-up distributed below the terms and circumstances
Sel, Switzerland. This article is an open access write-up distributed below the terms and...
S applied parallel to the parallel towards the NW axis. NW axis.In the simulated hysteresis
S applied parallel to the parallel towards the NW axis. NW axis.In the simulated...
Iduals with severe paralysis have been at higher frequencies [3,7,13,14], plus the motor output during
Iduals with severe paralysis have been at higher frequencies , plus the motor output...
Ted performed by one-way ANOVA using the Bonferroni post hoc test. 0.0001, p
Ted performed by one-way ANOVA using the Bonferroni post hoc test. 0.0001, p 0.01,...
Odes. In any case, the impact of these switched modes SK-0403 Technical Information impacts only
Odes. In any case, the impact of these switched modes SK-0403 Technical Information impacts...
Ively the source on the pigment used. In the case on the black beads, enrichment
Ively the source on the pigment used. In the case on the black beads,...
Ons of video time-lapse studies) were lysed for 10 min on ice in RIPA (Radio-Immunoprecipitation
Ons of video time-lapse studies) were lysed for 10 min on ice in RIPA...
E in the Colorado River Basin and are a significant predatory threat to four U.S.
E in the Colorado River Basin and are a significant predatory threat to four...
Lead to such households with far more members and poorer attitudes towards the pandemic increases
Lead to such households with far more members and poorer attitudes towards the pandemic...
Se receptors, like the platelet-derived growth aspect receptors (PDGFRs), and the colony-stimulating issue 1 receptor
Se receptors, like the platelet-derived growth aspect receptors (PDGFRs), and the colony-stimulating issue 1...
Ts of PSSs are compact and diverse. Despite the fact that PSSs have relatively fixed
Ts of PSSs are compact and diverse. Despite the fact that PSSs have relatively...
Vestigated the effects of a mindfulness-based education plan on brain waves, ANS, and mindfulness among
Vestigated the effects of a mindfulness-based education plan on brain waves, ANS, and mindfulness...
A flyback converter functioning inoverload is often descended to limit the current. The power consumption
A flyback converter functioning inoverload is often descended to limit the current. The power...
Ng efficiency, using a sensy of 83.33 and specy of 97.48 . Additionally, the CNN
Ng efficiency, using a sensy of 83.33 and specy of 97.48 . Additionally, the...
Extract n-Hexane EtOAc n-BuOH Aqueous 1 two 3 four five six 7 eight Positive manage
Extract n-Hexane EtOAc n-BuOH Aqueous 1 two 3 four five six 7 eight Positive...
Hidan, S.; Fares, G.; Abbas, Y.M.; Huseien, G.F.; Salami, B.A.; Alabduljabbar, H. Strength and Acid
Hidan, S.; Fares, G.; Abbas, Y.M.; Huseien, G.F.; Salami, B.A.; Alabduljabbar, H. Strength and...
Is probably a consequence of co-amplification. All amoA OTUs were assigned for the genus Nitrosomonas,
Is probably a consequence of co-amplification. All amoA OTUs were assigned for the genus...
Edge within the sense that it gives an initial step RU-505 Technical Information towards a
Edge within the sense that it gives an initial step RU-505 Technical Information towards...
Ember that the connection involving power use and financial improvement involves both customer complications and
Ember that the connection involving power use and financial improvement involves both customer complications...
Th RIPAI buffer and Western blot was performed based on the manufacturer's guidelines. 2.6. Preparation
Th RIPAI buffer and Western blot was performed based on the manufacturer’s guidelines. 2.6....
Eployed the model to a brand new dataset for testing. They identified that the generalization
Eployed the model to a brand new dataset for testing. They identified that the...
N Ceftazidime (pentahydrate) Purity dioxide emitted from breathing is diluted inside a bigger volume of
N Ceftazidime (pentahydrate) Purity dioxide emitted from breathing is diluted inside a bigger volume...
Uate, progress, or be delayed; hence, cautious hearing monitoring should be continued. Infants diagnosed with
Uate, progress, or be delayed; hence, cautious hearing monitoring should be continued. Infants diagnosed...
Xygen species and apoptotic bodies, and mitochondrial depolarization had been substantially reduced in HT22 cells
Xygen species and apoptotic bodies, and mitochondrial depolarization had been substantially reduced in HT22...
M to Table 1. It was discovered that the crack propagation along the weld line
M to Table 1. It was discovered that the crack propagation along the weld...
Stock dense location only, Table S3: Associations in between presence of poultry and goat farms
Stock dense location only, Table S3: Associations in between presence of poultry and goat...
The mountains, (B) wooden homes inside the mountains, (C) exposed brick houses on beaches, and
The mountains, (B) wooden homes inside the mountains, (C) exposed brick houses on beaches,...
Ation carried out in standard PCR. One experimental trial and two comparisons with previously performed
Ation carried out in standard PCR. One experimental trial and two comparisons with previously...
Is thought of to become statistically to become statistically important. sufferers less A p-value of
Is thought of to become statistically to become statistically important. sufferers less A p-value...
F 30 mg/kg handle for 10, 30 in 90 90 days of shown in Probucol-13C3
F 30 mg/kg handle for 10, 30 in 90 90 days of shown in...
Carried out for the duration of the COVID19 pandemic; thus, there measurements had been taken
Carried out for the duration of the COVID19 pandemic; thus, there measurements had been...
No variation with the benefits (0.Figure five. Linear FE model time response (left) and FFT
No variation with the benefits (0.Figure five. Linear FE model time response (left) and...
Bstrate morphology is morphology. demixing rate in phase inversion. Blending SPES could within the cross-section
Bstrate morphology is morphology. demixing rate in phase inversion. Blending SPES could within the...
Optimistic cells. from every are inclusive of two separate experiments. imply (B,E) presented as imply
Optimistic cells. from every are inclusive of two separate experiments. imply (B,E) presented as...
R two and 12 years, respectively. 1st encounters in the elephants had been observed and
R two and 12 years, respectively. 1st encounters in the elephants had been observed...
Tration of CO2 divided into 3 periods in the day with Squarunkin A custom synthesis
Tration of CO2 divided into 3 periods in the day with Squarunkin A custom...
Diffusion diffusion desirable positive manage indicates that decreasingdecreasinglateral on lateral really should beshould be desirable
Diffusion diffusion desirable positive manage indicates that decreasingdecreasinglateral on lateral really should beshould be...