Ded to the elutant, transferred to an RNeasyA Novel Technology for Cell Capture and Releasemini column and spun at 13400 g for 15 seconds. 500 ml wash buffer (RW1) was then added to the column and incubated for 5 minutes at room temperature before being spun at 13400 g for 15 seconds. Following this, 500 ml pre-warmed buffer RPE was added to the column and spun for 13400 g for 15 seconds. This step was repeated a second time and spun at 13400 g for 2 minutes. Finally, to elute RNA columns were transferred to RNase free tubes and 30 ml RNase free ddH2O added, incubated at room temperature for 2 minutes then spun at 13400 g for 1 minute. Quantity and purity of RNA was determined by spectrophotometry (260/280 nm absorbance). Only samples that had a 260/280 nm absorbance between 1.9 and 2.1 were used in subsequent experiments.Cross sequence homology was investigated by perfoming a basic local alignment search (BLAST) was then used to interrogate the rat genome to identify regions complementary to the 18325633 designed primers outside of the target gene. Primers displaying any cross sequence homology were rejected. Primers were synthesised at a production scale of 25 nM by Invitrogen.CD90+ isolation: mixed-mode ligand-coated beads (reversible antibody binding)In order to optimise loading of CD90 FITC-conjugated antibodies on mixed-mode (i.e. containing both aromatic and acidic groups) ligand beads (50?00 mm diameter, supplied by CellCap Technologies Ltd) several buffer configurations were explored; 200 mM TRIS or 0.1 M phosphate buffer adjusted to pH 5, 6 or 7.4. In each case beads were washed 3x in buffer before addition of 1 mg antibody/1 ml beads (15 mins, 4uC). Beads were then washed three times in the corresponding buffer to remove unbound antibody and antibody loading confirmed using fluorescent microscopy. Release was achieved by incubating beads for 15 mins at 4uC, at either pH 7.4 or 8.4, an additional blocking variable was also added which included incubation with 10 rabbit serum for 15 min prior to transfer to release buffer.Real-time PCR (qRT-PCR)Prior to reverse transcription the following stock solutions were created. Stock 1:1 ml 50 mM Oligo(dt)20, 1 ml 10 mM dNTP cocktail, 9 ml RNAse free ddH2O. Stock 2:4 ml 5x first strand buffers, 1 ml 0.1 M DTT, 1 ml RNaseOUT recombinant RNAse 117793 inhibitor (40 U/mL) and 1 ml superscript III RT (200 U/ml). The above stock solutions were suitable quantities for the reverse transcription of 2 ml of RNA (15?00 mg/ml RNA). 2 ml of RNA was added to stock 1 denatured at 65uC for 5 minutes followed immediately by a 1 minute chill at 220uC. Stock 2 was then added, heated for 40 minutes at 50uC, followed by a further 15 minutes at 70uC. All reagents were purchased from Invitrogen, UK. qRT-PCR reactions were assembled containing 2 ml cDNA diluted 100 fold using molecular biology grade ddH2O, 0.5 ml sense primer (100 mM), 0.5 ml antisense primer (100 mM), 7.5 ml Sybr green single tube PCR Iloprost chemical information master mix (Bio-Rad, UK) and 4.5 ml molecular biology grade ddH2O. Primers for gene of interest (CD90) and reference gene (b-actin) were designed in house. (CD90 sense: CTGCTGAGCCTTTGTGGAC, anti-sense; GCATCTTTATTGAGTGTG, TA: 50.1uC. b-actin: sense; GGGACCTGACTGACTACCTC, anti-sense; GCCATCTCTTGCTCGAAG, TA: 53.9uC). Reactions were denatured for 3 minutes at 95uC then cycled 40 times at 95uC for 30 seconds, followed by 40 cycles of annealing; 55uC for 30 seconds, 95uC for 30 seconds and finally 40 cycles at 55uC for 10 seconds. F.Ded to the elutant, transferred to an RNeasyA Novel Technology for Cell Capture and Releasemini column and spun at 13400 g for 15 seconds. 500 ml wash buffer (RW1) was then added to the column and incubated for 5 minutes at room temperature before being spun at 13400 g for 15 seconds. Following this, 500 ml pre-warmed buffer RPE was added to the column and spun for 13400 g for 15 seconds. This step was repeated a second time and spun at 13400 g for 2 minutes. Finally, to elute RNA columns were transferred to RNase free tubes and 30 ml RNase free ddH2O added, incubated at room temperature for 2 minutes then spun at 13400 g for 1 minute. Quantity and purity of RNA was determined by spectrophotometry (260/280 nm absorbance). Only samples that had a 260/280 nm absorbance between 1.9 and 2.1 were used in subsequent experiments.Cross sequence homology was investigated by perfoming a basic local alignment search (BLAST) was then used to interrogate the rat genome to identify regions complementary to the 18325633 designed primers outside of the target gene. Primers displaying any cross sequence homology were rejected. Primers were synthesised at a production scale of 25 nM by Invitrogen.CD90+ isolation: mixed-mode ligand-coated beads (reversible antibody binding)In order to optimise loading of CD90 FITC-conjugated antibodies on mixed-mode (i.e. containing both aromatic and acidic groups) ligand beads (50?00 mm diameter, supplied by CellCap Technologies Ltd) several buffer configurations were explored; 200 mM TRIS or 0.1 M phosphate buffer adjusted to pH 5, 6 or 7.4. In each case beads were washed 3x in buffer before addition of 1 mg antibody/1 ml beads (15 mins, 4uC). Beads were then washed three times in the corresponding buffer to remove unbound antibody and antibody loading confirmed using fluorescent microscopy. Release was achieved by incubating beads for 15 mins at 4uC, at either pH 7.4 or 8.4, an additional blocking variable was also added which included incubation with 10 rabbit serum for 15 min prior to transfer to release buffer.Real-time PCR (qRT-PCR)Prior to reverse transcription the following stock solutions were created. Stock 1:1 ml 50 mM Oligo(dt)20, 1 ml 10 mM dNTP cocktail, 9 ml RNAse free ddH2O. Stock 2:4 ml 5x first strand buffers, 1 ml 0.1 M DTT, 1 ml RNaseOUT recombinant RNAse inhibitor (40 U/mL) and 1 ml superscript III RT (200 U/ml). The above stock solutions were suitable quantities for the reverse transcription of 2 ml of RNA (15?00 mg/ml RNA). 2 ml of RNA was added to stock 1 denatured at 65uC for 5 minutes followed immediately by a 1 minute chill at 220uC. Stock 2 was then added, heated for 40 minutes at 50uC, followed by a further 15 minutes at 70uC. All reagents were purchased from Invitrogen, UK. qRT-PCR reactions were assembled containing 2 ml cDNA diluted 100 fold using molecular biology grade ddH2O, 0.5 ml sense primer (100 mM), 0.5 ml antisense primer (100 mM), 7.5 ml Sybr green single tube PCR master mix (Bio-Rad, UK) and 4.5 ml molecular biology grade ddH2O. Primers for gene of interest (CD90) and reference gene (b-actin) were designed in house. (CD90 sense: CTGCTGAGCCTTTGTGGAC, anti-sense; GCATCTTTATTGAGTGTG, TA: 50.1uC. b-actin: sense; GGGACCTGACTGACTACCTC, anti-sense; GCCATCTCTTGCTCGAAG, TA: 53.9uC). Reactions were denatured for 3 minutes at 95uC then cycled 40 times at 95uC for 30 seconds, followed by 40 cycles of annealing; 55uC for 30 seconds, 95uC for 30 seconds and finally 40 cycles at 55uC for 10 seconds. F.
