To early defects in formation of the two lineages. As a result we tested if cranial TXA2/TP Antagonist Formulation mesenchyme undergoes properWnt Sources in Cranial Dermis and Bone FormationFigure 1. α adrenergic receptor Agonist review Expression of Wnt ligands, Wntless, and Wnt signaling response in cranial ectoderm and mesenchyme. (A, B) RT-PCR for individual Wnt ligands was performed on cDNA from purified mouse embryonic cranial mesenchyme and surface ectoderm. (C, D G, H) Indirect immunofluorescence with DAPI counterstained nuclei (blue), (E) in situ hybridization, or immunohistochemistry (F, I) was performed on coronal mouse embryonic head sections. (G, H, I) Boxes indicate area in insets at larger magnification. White arrowheads indicate co-expression of (G) Wls/ Runx2 or (D,H) Lef1/Runx2, (I) red arrowheads indicate osteoblast progenitors, and blue arrowheads indicate dermal progenitors. (F ) White hatched lines demarcate ectoderm from mesenchyme. (J) Summary scheme of E12.five supraorbital cranial mesenchyme. (J) Embryonic axes, figure depicts lateral view of embryonic head, area of interest in sections used in figures are shown. Scale bars represent 100 mm. doi:10.1371/journal.pgen.1004152.gpatterning, fate choice, and differentiation within the absence of Wls. Msx2 and Dlx5 which might be early markers of skeletogenic patterning in cranial mesenchyme were expressed in Crect; Wls fl/fl mutantsPLOS Genetics | plosgenetics.org(Figures 4A, H, S4). The amount of Msx2+ progenitor cells was not substantially distinctive in controls and mutants (19169.four in controls and 206624 in mutants, P-value = 0.23). Even so, fewWnt Sources in Cranial Dermis and Bone FormationTable 1. Primer sequences for RT-PCR of mouse Wnt genes.Ligand Wnt1 F Wnt1 R Wnt2 F Wnt2 R Wnt2b F Wnt2b R Wnt3 F Wnt3 R Wnt3a F Wnt3a R Wnt4 F Wnt4 R Wnt5a F Wnt5a R Wnt5b F Wnt5b R Wnt6 F Wnt6 R Wnt7a F Wnt7a R Wnt 7b F Wnt 7b R Wnt 8a F Wnt 8a R Wnt 8b F Wnt 8b R Wnt 9a F Wnt 9a R Wnt 9b F Wnt 9b R Wnt 10a F Wnt 10a R Wnt 10b F Wnt 10b R Wnt 11 F Wnt 11 R Wnt 16 F Wnt 16 RPrimers ATGAACCTTCACAACAACGAG GGTTGCTGCCTCGGTTG CTGGCTCTGGCTCCCTCTG GGAACTGGTGTTGGCACTCTG CGTTCGTCTATGCTATCTCGTCAG ACACCGTAATGGATGTTGTCACTAC CAAGCACAACAATGAAGCAGGC TCGGGACTCACGGTGTTTCTC CACCACCGTCAGCAACAGCC AGGAGCGTGTCACTGCGAAAG GAGAAGTGTGGCTGTGACCGG ATGTTGTCCGAGCATCCTGACC CTCCTTCGCCCAGGTTGTTATAG TGTCTTCGCACCTTCTCCAATG ATGCCCGAGAGCGTGAGAAG ACATTTGCAGGCGACATCAGC TGCCCGAGGCGCAAGACTG ATTGCAAACACGAAAGCTGTCTCTC CTTCATGTTCTCCTCCAGGATCTTC CGACTGTGGCTGCGACAAG TCTCTGCTTTGGCGTCCTCTAC GCCAGGCCAGGAATCTTGTTG ACGGTGGAATTGTCCTGAGCATG GATGGCAGCAGAGCGGATGG TTGGGACCGTTGGAATTGCC AGTCATCACAGCCACAGTTGTC GCAGCAAGTTTGTCAAGGAGTTCC GCAGGAGCCAGACACACCATG AAGTACAGCACCAAGTTCCTCAGC GAACAGCACAGGAGCCTGACAC CCTGTTCTTCCTACTGCTGCTGG CGATCTGGATGCCCTGGATAGC TTCTCTCGGGATTTCTTGGATTC TGCACTTCCGCTTCAGGTTTTC CTGAATCAGACGCAACACTGTAAAC CTCTCTCCAGGTCAAGCAGGTAG AGTAGCGGCACCAAGGAGAC GAAACTTTCTGCTGAACCACATGCTm (1 um Primer) 59 63 64 64 63 62 65 66 68 65 67 66 64 66 64 64 72 66 64 64 64 63 66 68 68 61 66 67 64 65 65 68 63 66 63 63 63SizeIntron-exon junction yesGENEBANKCoordinates – Dec. 2011 (GRCm38/mm10) chr15:98,791,9258,791,945 chr15:98,792,5688,792,yeschr6:18,027,9938,028,013 chr6:18,030,2468,030,nochr3:104,953,15404,953,177 chr3:104,953,00904,953,yeschr11:103,811,56603,811,587 chr11:103,812,43103,812,yeschr11:59,275,1709,275,189 chr11:59,256,4779,256,yeschr4:137,295,52737,295,547 chr4:137,295,66937,295,yes371940977chr14:28,511,9188,511,940 chr14:28,513,2768,513,297 chr6:119,440,35419,440,373 chr6:119,433,82119,433,841 chr.
